설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TCATATCCCACAGTCCAGCAGCTACTGTAGCCTGCATCCACACGAACGTTTGAGCTATCCATCCCACTCCTCGGCAGACATCAACTCCAGTCTTCCTCCGATGTCCACGTTCCATCGTAGTGGCACAAACCATTACAGCACCTCTTCCTGCACACCCCCTGCCAACGGAACAGACAGTATAATGGCAAACAGAGGAACTGGGGCAGCAGGCAGCTCGCAGACTGGAGACGCTCTGGGGAAAGCCCTAGCTTCGATCTATTCTCCTGACCACACGAACAACAGCTTTTCCTCCAATCCTTCAACTCCTGTGGGCTCCCCTCCTTCACTCTCAGCAGGCACAGCTGTTTGGTCTAGAAATGGAGGACAGGCCTCGTCATCTCCCAATTATGAAGGACCCTTGCACTCACTGCAAAGCCGAATCGAAGACCGTTTGGAA
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... TCF4(21413) , Tcf4(21413)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
J Wang et al.
British journal of cancer, 111(1), 112-124 (2014-05-31)
Invasion and metastasis remain a critical issue in cervical cancer. However, the underlying mechanism of it in cervical cancer remains unclear. The newly discovered protein, TBLR1, plays a crucial role in regulating various key cellular functions. In this study, western
Menglan Cheng et al.
Scientific reports, 5, 10752-10752 (2015-07-18)
Dendritic cells (DCs) are sentinels of the immune system and comprise two distinct subsets: conventional DCs (cDCs) and plasmacytoid DCs (pDCs). Human pDCs are distinguished from mouse pDCs phenotypically and functionally. Basic helix-loop-helix protein E2-2 is defined as an essential
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.