콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU016141

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Foxm1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

AGCGTTAAGCAGGAACTGGAAGAGAAGGAGAATTGTCACCTGGAGCAGAATCGGGTTAAGGTTGAGGAGCCCTCAGGAGTGTCAACATCTTGGCAGGACTCTGTGTCTGAGAGGCCACCCTACTCTTATATGGCCATGATACAGTTTGCCATCAACAGCACTGAGAGAAAGCGCATGACCTTGAAGGACATCTACACTTGGATTGAGGACCACTTCCCTTACTTTAAGCACATTGCCAAGCCAGGCTGGAAGAACTCTATTCGTCACAACCTTTCTCTCCATGACATGTTTGTTCGAGAGACATCTGCCAATGGCAAGGTCTCCTTCTGGACCATTCACCCAAGTGCCAATCGCTACTTGACATTGGACCAAGTGTTTAAGCCACTGGAACCAGGGTCTCCACAATCGCCCGAGCACTTGGAATCACAGCA

Ensembl | 마우스 수납 번호

ENSMUSG00000001517

NCBI 수납 번호

NM_008021

배송 상태

ambient

저장 온도

−20°C

유전자 정보

mouse ... FOXM1(14235) , Foxm1(14235)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
VPU
VOU
TCS

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Xiaoxiao Li et al.
Journal of translational medicine, 11, 204-204 (2013-09-06)
Forkhead box transcription factor 1 (FOXM1) has been reported to overexpress and correlate with pathogenesis in a variety of human malignancies. However, little research has been done to investigate its clinical significance in gastric cancer. We examined the expression of
KanKan Yang et al.
Journal of experimental & clinical cancer research : CR, 34, 40-40 (2015-05-04)
The Forkhead box M1 (FOXM1) is an oncogenic transcription factor and plays a significant role in cell EMT, proliferation, metastasis in a multitude of human solid tumors including colorectal cancer (CRC). However, the underlying molecular mechanisms by which FoxM1 contributes
Jiujie Cui et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(10), 2595-2606 (2014-03-19)
The transcription factor Forkhead box protein M1 (FOXM1) plays critical roles in cancer development and progression. However, the regulatory role and underlying mechanisms of FOXM1 in cancer metabolism are unknown. In this study, we characterized the regulation of aerobic glycolysis
Satoru Inoguchi et al.
FEBS letters, 588(17), 3170-3179 (2014-07-08)
Here, we found that microRNA-24-1 (miR-24-1) is significantly reduced in bladder cancer (BC) tissues, suggesting that it functions as a tumour suppressor. Restoration of mature miR-24-1 inhibits cancer cell proliferation and induces apoptosis. Forkhead box protein M1 (FOXM1) is a
Weihua Jiang et al.
International journal of clinical and experimental pathology, 8(6), 6756-6763 (2015-08-12)
The oncogenic transcription factor forkhead box protein M1 (FOXM1) plays critical roles in gastric cancer (GC) development and progression. However, the underlying mechanisms has not fully demonstrated. Lactate dehydrogenase A (LDHA) is widely overexpressed in a series of cancers and
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.