콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EMU015681

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cyba

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TGGACGTTTCACACAGTGGTATTTCGGCGCCTACTCTATCGCTGCAGGTGTGCTCATCTGTCTGCTGGAGTATCCCCGGGGAAAGAGGAAAAAGGGGTCCACCATGGAGCGATGTGGACAGAAGTACCTGACCCCTGTGGTGAAGCTTTTCGGGCCCCTCACCAGGAATTACTACGTCCGGGCTGCCCTCCACTTCCTGTTGTCGGTGCCTGCAGGCTTCCTCCTGGCCACCATCCTGGGGACCGTCTGCTTGGCCATTGCCAGTGTGATCTATCTGCTGGCAGCCATCCGAGGTGAGCAGTGGACTCCCATTGAGCCTAAACCCAAGGAGCGGCCACAGGTTGGAGGCACCATCAAGCAACCACCTACCAACCCCCCACCCCGGCCACCCGCAGAGGTCCGAAAGAAGCCGAGTGAGGGTGAAGAGGAG

Ensembl | 마우스 수납 번호

ENSMUSG00000006519

NCBI 수납 번호

NM_007806

배송 상태

ambient

저장 온도

−20°C

유전자 정보

mouse ... CYBA(13057) , Cyba(13057)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Rui Yamaguchi et al.
Blood cells, molecules & diseases, 57, 85-90 (2016-02-09)
Granulocyte-macrophage colony stimulating factor (GM-CSF) induces procoagulant activity of macrophages. Tissue factor (TF) is a membrane-bound glycoprotein and substance P (SP) is a pro-inflammatory neuropeptide involved in the formation of membrane blebs. This study investigated the role of SP in
Jessica M Overstreet et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 29(4), 1258-1268 (2014-12-07)
Effective therapy to prevent organ fibrosis, which is associated with more than half of all mortalities, remains elusive. Involvement of tumor suppressor ataxia telangiectasia mutated (ATM) in the TGF-β1 pathway related to renal fibrosis is largely unknown. ATM activation (pATM(Ser1981))
Young-Hoon Lee et al.
FEBS letters, 588(17), 3251-3258 (2014-07-30)
The expression of phospholipase D1 (PLD1) and PLD2 were found to decrease at the transcription level during both replicative and premature senescence in human lung fibroblast IMR-90 cells. Knockdown of PLD2 dramatically induced senescent phenotype in proliferating IMR-90 cells and
Chih-Chang Hung et al.
Oncotarget, 6(6), 4110-4125 (2015-02-18)
Cisplatin (CDDP) is a potent chemotherapeutic agent but resistance to the drug remains a major challenge in cancer treatment. To evaluate the efficacy of CDDP in oral squamous cell carcinoma (OSCC), we found that p22phox was highly expressed in CDDP-resistant

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.