설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GGTGGTGGAACCTTTGACATTTCTATCCTGGAAATTCAGAAAGGAGTGTTTGAGGTGAAATCTACCAATGGGGACACTTTCTTAGGAGGGGAAGACTTTGACCAAGCTTTGTTGCGGCACATTGTCAAGGAGTTCAAGAGAGAGACAGGGGTTGATTTGACCAAAGACAACATGGCGCTTCAGAGGGTTCGGGAAGCTGCTGAGAAGGCTAAATGTGAACTTTCCTCATCTGTGCAGACTGACATCAACTTGCCATACCTTACCATGGATGCTTCTGGACCAAAGCATTTGAATATGAAGCTGACTCGAGCTCAGTTTGAAGGCATTGTCACAGATCTAATCAAGAGAACTATTGCTCCGTGTCAGAAAGCTATGCAGGATGCAGAAGTCAGCAAGAGTGACATAGGAGAAGTGATTCTGGTTGGTGGC
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... HSPA9(15526) , Hspa9(15526)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Yuxi Shan et al.
Mitochondrion, 26, 94-103 (2015-12-26)
Mitochondrial iron-sulfur cluster (ISC) biogenesis provides iron-sulfur cofactors to several mitochondrial proteins, but the extent to which ISC biogenesis regulates hematopoiesis has been unclear. The blood disease Myelodysplastic syndrome (MDS) is characterized by ineffective hematopoiesis, and the disease overlaps with
Jia-You Fang et al.
Proteomics, 14(21-22), 2588-2599 (2014-09-12)
Lead compounds exhibit a high degree of cytotoxicity and carcinogenicity. We evaluated the impact of lead acetate on the liver by skin exposure as well as the changes in protein profiles reflecting pathogenic processes. Functional proteomic tools showed that the
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.