설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CTGGATGTGATAGGCCAGGTTCTGCCTGAAGCGACGACGACAGCGTTTGAATATGAAGATGAAGATGGTGATAGGATTACAGTAAGAAGCGATGAAGAGATGAAGGCAATGCTGTCCTACTATTATTCCACAGTAATGGAACAGCAAGTAAATGGCCAGCTAATAGAGCCGCTGCAGATATTTCCAAGAGCCTGCAAGCCTCCCGGGGAACGGAACATACATGGCCTGAAGGTGAATACACGGGCTGGGCCATCTCAACACACCAGCCCTGTGGTCTCAGATTCGCTTCCAAGCAATAGCTTGAAGAAGTCCTCAGCTGAACTGAGAAAGATACTGGCCAACGGCCAGATGAATGAACAAGACATACGGTATCGAGACACCCTTGGTCATGGCAACGGAGGCACAGTCTACAAAGCACATCATGTCCCA
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... MAP2K5(23938) , Map2k5(23938)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Shigeru Amano et al.
PloS one, 10(4), e0125054-e0125054 (2015-04-18)
The MEK/ERK pathways are critical for controlling cell proliferation and differentiation. In this study, we show that the MEK5/ERK5 pathway participates in osteoclast differentiation. ERK5 was activated by M-CSF, which is one of the essential factors in osteoclast differentiation. Inhibition
Shoichi Kaneshiro et al.
Biochemical and biophysical research communications, 463(3), 241-247 (2015-05-23)
Extracellular signal-regulated kinase 5 (ERK5) is a member of the mitogen-activated protein kinase (MAPK) family and is activated by its upstream kinase, MAPK kinase 5 (MEK5), which is a member of the MEK family. Although the role of MEK5 has
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.