설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CATCCGTATGAGCTTCGTCAAAGGCTGGGGAGCAGAGTACAGGAGACAGACAGTGACCAGCACCCCCTGCTGGATTGAGCTACACCTGAATGGACCCTTGCAGTGGCTTGTCAAGGTCCTCACCCAGATGGGTTCCCCGAGCATCCGCTGTTCCAGTGTGTCTTAGAGACACTAGGAGTAAAGGGAGCGGGTTGGGGAGGGCGGGCTTGGGGAAAATGACCTTGGAAGAGAACTCCATCCAACTTGGTCTTGTCAAAGAACACCGATTCCACTCAACTAAGGCACCAGCCTGTTTCTGAGACCACAGAAGAAAACCCCAGGGATGGATTTATGAACAGCTGTGTCTGCTACATACACGTGCCCCTGTCTGAAGGCCAAGTGATGGCTTCTGTTCTGGTGGCTTGAACTAACAGGTGGTGTATCGCCA
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... SMAD3(17127) , Smad3(17127)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Tianli Cheng et al.
International journal of oncology, 45(5), 1977-1988 (2014-09-02)
Altered expression of miRNAs contributes to development and progression of non-small cell lung cancer (NSCLC), while transforming growth factor-β (TGF-β) promotes NSCLC cell epithelial-mesenchymal transition. This study aimed to investigate the effects of TGF-β-induced miR‑143 expression in regulation of NSCLC
A Sakoguchi et al.
Clinical and experimental rheumatology, 32(6 Suppl 86) (2014-06-25)
The toll-like receptor (TLR) family is thought to be expressed in many cell types in the skin and play a role in various diseases. The expression pattern and role of TLRs in systemic sclerosis (SSc) is to be clarified. We
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.