콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU014261

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Vipr1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CAAGGATATGGCCCTCTTCAACAACGGGGAGACAGACCACTGCTCTGAGGCCTCGGTGAGCTGCAAGGCAGCAGTGGTTTTCTTCCAGTATTGCGTCATGGCCAACTTCTTCTGGCTGCTGGTCGAGGGCCTCTACCTACACACCCTGCTGGCCGTCTCCTTCTTCTCTGAGCGGAAGTACTTCTGGGGGTACATACTCATCGGCTGGGGAGTGCCCAGTGTGTTCATCATGATATGGACGATTGTCAGGATCCATTTTGAGGATTTCGGGTGCTGGGACACCATCATCAACTCCTCACTGTGGTGGATCATAAAGGGCCCCATCCTCATCTCCATCTTGGTGAACTTCATCCTGTTTATCTGCATCATCCGAATCCTGGTTCAGAAGCTACGGCCACCCGACATTGGGAAGAATGATAGCAGCCCA

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Caitlin J Bowen et al.
Developmental biology, 407(1), 145-157 (2015-07-19)
Proper remodeling of the endocardial cushions into thin fibrous valves is essential for gestational progression and long-term function. This process involves dynamic interactions between resident cells and their local environment, much of which is not understood. In this study, we
Tomas Baldassarre et al.
Molecular cancer research : MCR, 13(6), 1044-1055 (2015-03-19)
Triple-negative breast cancers (TNBCs) are highly aggressive cancers that lack targeted therapies. However, EGFR is frequently activated in a subset of TNBCs and represents a viable clinical target. Because the endocytic adaptor protein Endophilin A2 (SH3GL1/Endo II) has been implicated
Zheren Shao et al.
PloS one, 10(7), e0132655-e0132655 (2015-07-24)
Melanomas cause over 76% of skin cancer deaths annually. Phosphatidylinositol 3-kinase (PI3K)-AKT-mammalian target of rapamycin (mTOR) signaling pathway is important for melanoma initiation and progression. In the current study, we evaluated the potential anti-melanoma effect of VS-5584, a novel and
Alexandre K Rouquette-Jazdanian et al.
PloS one, 10(6), e0131823-e0131823 (2015-06-30)
Linker for Activation of T cells (LAT) is an adapter protein that is essential for T cell function. Knock-in mice with a LAT mutation impairing calcium flux develop a fatal CD4+ lymphoproliferative disease. miR-155 is a microRNA that is correlated

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.