설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TCTACCTAGGTCCCGTGTGGCCAGCCCCTTCCAACAGCACCCCTCTGGCCCTCAACTTGTCCCTGGCACTGCGGGAAGATGCCCCGGGGAACCTCACTGGGGACCTCTCTGAGCATCAGCAGTACGTGATTGCCCTCTTCCTCTCCTGCCTCTACACCATCTTCCTCTTTCCTATTGGCTTTGTGGGCAACATCCTCATCCTGGTGGTGAACATCAGCTTCCGGGAGAAGATGACCATCCCAGACCTGTACTTCATCAACCTGGCGGCGGCCGACCTCATCCTGGTGGCTGACTCCCTGATTGAGGTGTTCAACCTGGACGAGCAGTACTACGACATCGCAGTGCTCTGCACCTTCATGTCCCTCTTCCTGCAGATCAACATGTACAGCAGCGTCTTCTTCCTCACCTGGATGAGCTT
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... GPER(76854) , Gper(76854)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Wenqing Cao et al.
PloS one, 7(12), e52838-e52838 (2013-01-04)
Although evidence has shown the regulating effect of n-3 poly-unsaturated fatty acid (n-3 PUFA) on cell signaling transduction, it remains unknown whether n-3 PUFA treatment modulates estrogen signaling. The current study showed that docosahexaenoic acid (DHA, C22:6), eicosapentaenoic acid (EPA
Whitney K Petrie et al.
Obstetrics and gynecology international, 2013, 472720-472720 (2014-01-01)
Endometrial carcinoma is the most common cancer of the female reproductive tract. GPER/GPR30 is a 7-transmembrane spanning G protein-coupled receptor that has been identified as the third estrogen receptor, in addition to ERα and ERβ. High GPER expression is predictive
Rainer Girgert et al.
Breast cancer research and treatment, 134(1), 199-205 (2012-02-01)
Triple-negative breast cancers lack estrogen receptor α (ERα), progesterone receptor, and do not overexpress human epidermal growth factor receptor 2 (Her-2). They are neither susceptible to endocrine therapy nor to a therapy using the anti-Her-2 antibody, trastuzumab. Therefore, an efficient
Q K Y Chan et al.
Cell death and differentiation, 17(9), 1511-1523 (2010-03-06)
G-protein-coupled receptor-30 (GPR30) shows estrogen-binding affinity and mediates non-genomic signaling of estrogen to regulate cell growth. We here showed for the first time, in contrast to the reported promoting action of GPR30 on the growth of breast and ovarian cancer
Nicolas Chevalier et al.
PloS one, 7(4), e34672-e34672 (2012-04-13)
Testicular germ cell tumours are the most frequent cancer of young men with an increasing incidence all over the world. Pathogenesis and reasons of this increase remain unknown but epidemiological and clinical data have suggested that fetal exposure to environmental
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.