콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU003031

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Xiap

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CCGGGAGCAGCTATCTATCACTTGAGGTCCTGATTGCAGATCTTGTGAGTGCTCAGAAAGATAATACGGAGGATGAGTCAAGTCAAACTTCATTGCAGAAAGACATTAGTACTGAAGAGCAGCTAAGGCGCCTACAAGAGGAGAAGCTTTCCAAAATCTGTATGGATAGAAATATTGCTATCGTTTTTTTTCCTTGTGGACATCTGGCCACTTGTAAACAGTGTGCAGAAGCAGTTGACAAATGTCCCATGTGCTACACCGTCATTACGTTCAACCAAAAAATTTTTATGTCTTAGTGGGGCACCACATGTTATGTTCTTCTTGCTCTAATTGAATGTGTAATGGGAGCGAACTTTAAGTAATCCTGCATTTGCATTCCATTAGCATCCTGCTGTTTCCAAATGG

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

mouse ... Xiap(11798)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Anak A S S K Dharmapatni et al.
Mediators of inflammation, 2015, 564042-564042 (2015-09-09)
To investigate the effect of Embelin, an inhibitor of X-Linked Inhibitor of Apoptosis Protein (XIAP), on inflammation and bone erosion in a collagen antibody induced arthritis (CAIA) in mice. Four groups of mice (n = 6 per group) were allocated:
Azhar R Hussain et al.
The Journal of clinical endocrinology and metabolism, 100(7), E974-E985 (2015-05-15)
Papillary thyroid cancer (PTC) is the second most common cancer in females in Saudi Arabia. However, the pathogenesis of PTC is still not fully elucidated. To identify potential genes that play important role in progression of PTC, we studied the
N Raulf et al.
British journal of cancer, 111(10), 1955-1964 (2014-10-15)
Current treatment strategies for head and neck cancer are associated with significant morbidity and up to 50% of patients relapse, highlighting the need for more specific and effective therapeutics. Tumour necrosis factor-related apoptosis-inducing ligand (TRAIL) and Smac mimetics (SMs) are
Sojung Park et al.
Anticancer research, 34(7), 3557-3562 (2014-07-02)
Despite the selectivity of Tumor necrosis factor Related Apoptosis-Inducing Ligand (TRAIL) for cancer cell killing activity, breast cancer cells are resistant to TRAIL-induced apoptosis for various reasons. From a functionally-characterized small-molecule dataset, CGP74514A was identified as a TRAIL sensitizer in
Cheng-Yu Tsai et al.
Metallomics : integrated biometal science, 7(11), 1477-1487 (2015-07-25)
Mammalian cells have two influx Cu transporters that form trimers in membranes. CTR1 is the high affinity transporter that resides largely in the plasma membrane, and CTR2 is the low affinity transporter that is primarily associated with vesicular structures inside

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.