설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
CCGGGAGCAGCTATCTATCACTTGAGGTCCTGATTGCAGATCTTGTGAGTGCTCAGAAAGATAATACGGAGGATGAGTCAAGTCAAACTTCATTGCAGAAAGACATTAGTACTGAAGAGCAGCTAAGGCGCCTACAAGAGGAGAAGCTTTCCAAAATCTGTATGGATAGAAATATTGCTATCGTTTTTTTTCCTTGTGGACATCTGGCCACTTGTAAACAGTGTGCAGAAGCAGTTGACAAATGTCCCATGTGCTACACCGTCATTACGTTCAACCAAAAAATTTTTATGTCTTAGTGGGGCACCACATGTTATGTTCTTCTTGCTCTAATTGAATGTGTAATGGGAGCGAACTTTAAGTAATCCTGCATTTGCATTCCATTAGCATCCTGCTGTTTCCAAATGG
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... Xiap(11798)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Mediators of inflammation, 2015, 564042-564042 (2015-09-09)
To investigate the effect of Embelin, an inhibitor of X-Linked Inhibitor of Apoptosis Protein (XIAP), on inflammation and bone erosion in a collagen antibody induced arthritis (CAIA) in mice. Four groups of mice (n = 6 per group) were allocated:
The Journal of clinical endocrinology and metabolism, 100(7), E974-E985 (2015-05-15)
Papillary thyroid cancer (PTC) is the second most common cancer in females in Saudi Arabia. However, the pathogenesis of PTC is still not fully elucidated. To identify potential genes that play important role in progression of PTC, we studied the
British journal of cancer, 111(10), 1955-1964 (2014-10-15)
Current treatment strategies for head and neck cancer are associated with significant morbidity and up to 50% of patients relapse, highlighting the need for more specific and effective therapeutics. Tumour necrosis factor-related apoptosis-inducing ligand (TRAIL) and Smac mimetics (SMs) are
Anticancer research, 34(7), 3557-3562 (2014-07-02)
Despite the selectivity of Tumor necrosis factor Related Apoptosis-Inducing Ligand (TRAIL) for cancer cell killing activity, breast cancer cells are resistant to TRAIL-induced apoptosis for various reasons. From a functionally-characterized small-molecule dataset, CGP74514A was identified as a TRAIL sensitizer in
Metallomics : integrated biometal science, 7(11), 1477-1487 (2015-07-25)
Mammalian cells have two influx Cu transporters that form trimers in membranes. CTR1 is the high affinity transporter that resides largely in the plasma membrane, and CTR2 is the low affinity transporter that is primarily associated with vesicular structures inside
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.