콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU001091

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Elavl1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CCCTCAGAACATGACCCAAGAGGAACTACGAAGTCTGTTCAGCAGCATTGGCGAGGTTGAATCTGCAAAGCTTATTCGGGATAAAGTAGCAGGACACAGCTTGGGCTACGGTTTTGTGAACTATGTGACTGCAAAAGATGCAGAGAGAGCAATCAGCACACTGAACGGCTTGAGACTCCAGTCCAAAACCATTAAGGTGTCATATGCTCGCCCAAGCTCAGAGGTCATCAAAGATGCCAACTTATACATCAGTGGGCTCCCAAGGACCATGACACAGAAGGATGTGGAAGACATGTTTTCTCGGTTTGGGCGAATCATCAACTCCAGGGTCCTTGTGGATCAGACCACAGGTTTGTCCAGAGGGGTTGCCTTTATCCGGTTTGACAAACGGTCAGAAGCAG

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Danping Wu et al.
Clinical laboratory, 61(11), 1625-1634 (2016-01-07)
Increasing evidence suggests that microRNAs are widely involved in cancer progression and metastasis. However, the specific role of miR-31 in papillary thyroid carcinoma (PTC) is still largely unknown. The level of miR-31 and HuR was detected in 30 pairedcancerous and
Kotb Abdelmohsen et al.
Nucleic acids research, 42(15), 10099-10111 (2014-08-16)
Noncoding RNAs (ncRNAs) and RNA-binding proteins are potent post-transcriptional regulators of gene expression. The ncRNA 7SL is upregulated in cancer cells, but its impact upon the phenotype of cancer cells is unknown. Here, we present evidence that 7SL forms a
Kenneth K W To et al.
Experimental cell research, 338(2), 222-231 (2015-09-20)
Colorectal cancer (CRC) is a major cause of mortality and morbidity worldwide. While surgery remains the mainstay of treatment for early stage CRC, adjuvant chemotherapy is usually given to reduce the risk of recurrence after colectomy. Overexpression of a multidrug
Cristina M Ramírez et al.
Journal of lipid research, 55(6), 1066-1076 (2014-04-15)
ABCA1 is a major regulator of cellular cholesterol efflux and plasma HDL biogenesis. Even though the transcriptional activation of ABCA1 is well established, the posttranscriptional regulation of ABCA1 expression is poorly understood. Here, we investigate the potential contribution of the
Jeong-Dan Cha et al.
Head & neck, 36(8), 1168-1175 (2013-07-16)
HuR expression has been noted in several cancer types, in which it may contribute to increased expression of cellular inhibitors of apoptosis protein-2 (cIAP2) observed during tumorigenesis. To assess the correlation between cIAP2 and HuR in cases of oral squamous

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.