콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU000411

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Sirt1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TAAGCGGCTTGAGGGTAATCAATACCTGTTTGTACCACCAAATCGTTACATATTCCACGGTGCTGAGGTATACTCAGACTCTGAAGATGACGTCTTGTCCTCTAGTTCCTGTGGCAGTAACAGTGACAGTGGCACATGCCAGAGTCCAAGTTTAGAAGAACCCTTGGAAGATGAAAGTGAAATTGAAGAATTCTACAATGGCTTGGAAGATGATACGGAGAGGCCCGAATGTGCTGGAGGATCTGGATTTGGAGCTGATGGAGGGGATCAAGAGGTTGTTAATGAAGCTATAGCTACAAGACAGGAATTGACAGATGTAAACTATCCATCAGACAAATCATAACACTATTGAAGCTGTCCGGATTCAGGAATTGCTCCACCAGCATTGGGAACTTTAGCA

Ensembl | 마우스 수납 번호

ENSMUSG00000020063

NCBI 수납 번호

NP_062786

배송 상태

ambient

저장 온도

−20°C

유전자 정보

mouse ... SIRT1(93759) , Sirt1(93759)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jie-Ning Zhu et al.
Scientific reports, 7(1), 11879-11879 (2017-09-21)
The molecular mechanisms underlying anthracyclines-induced cardiotoxicity have not been well elucidated. MiRNAs were revealed dysregulated in the myocardium and plasma of rats received Dox treatment. MicroRNA-34a-5p (miR-34a-5p) was verified increased in the myocardium and plasma of Dox-treated rats, but was
Yi Fu et al.
Cell metabolism, 32(6), 1052-1062 (2020-11-14)
Lipid accumulation in podocytes is a major determinant of diabetic kidney disease (DKD) and identification of potential therapeutic targets by mediating podocyte lipid metabolism has clinical importance. This study was to elucidate the role of JAML (junctional adhesion molecule-like protein)
Hisae Yoshitomi et al.
PloS one, 12(8), e0183988-e0183988 (2017-09-01)
Diabetes is caused by the lack of release or action of insulin. Some foods and supplements can compensate for this deficiency; thus, they can aid in the prevention or treatment of diabetes. The aim of this study was to investigate
Xiwen Xiong et al.
PloS one, 14(2), e0212523-e0212523 (2019-02-23)
Nicotinamide phosphoribosyltransferase (NAMPT) is a rate-limiting enzyme in mammalian nicotinamide adenine dinucleotide (NAD)+ biosynthesis. Through its NAD+-biosynthetic activity, NAMPT influences the activity of NAD+-dependent enzymes, such as sirtuins. NAMPT is able to modulate processes involved in the pathogenesis of non-alcohol
Mickaël Ohanna et al.
Oncotarget, 5(8), 2085-2095 (2014-04-20)
SIRT1 operates as both a tumor suppressor and oncogenic factor depending on the cell context. Whether SIRT1 plays a role in melanoma biology remained poorly elucidated. Here, we demonstrate that SIRT1 is a critical regulator of melanoma cell proliferation. SIRT1
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.