콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU218531

Sigma-Aldrich

MISSION® esiRNA

targeting human GPX1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CGCCAAGAACGAAGAGATTCTGAATTCCCTCAAGTACGTCCGGCCTGGTGGTGGGTTCGAGCCCAACTTCATGCTCTTCGAGAAGTGCGAGGTGAACGGTGCGGGGGCGCACCCTCTCTTCGCCTTCCTGCGGGAGGCCCTGCCAGCTCCCAGCGACGACGCCACCGCGCTTATGACCGACCCCAAGCTCATCACCTGGTCTCCGGTGTGTCGCAACGATGTTGCCTGGAACTTTGAGAAGTTCCTGGTGGGCCCTGACGGTGTGCCCCTACGCAGGTACAGCCGCCGCTTCCAGACCATTGACATCGAGCCTGACATCGAAGCCCTGCTGTCTCAAGGGCCCAGCTGTGCCTAGGGCGCCCCTCCTACCCCGGCTGCTTGGCAGTTGCAGTGCTGCTGTCTCGGGGGGGTTTTCATCTATGAGGGTGTTTCCTCTAAACCTACGAGGGAGGAACACCTGATCTTACAGAAAATACCACCTCGAGATGGGTGCTGGTCCTGTTGATCCCAGT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Zhiquan Huang et al.
International journal of oncology, 48(3), 1271-1279 (2016-01-20)
1,25-Dihydroxyvitamin D3 (1,25D3) is the active form of vitamin D with antineoplastic effects. The glutathione peroxidase-1 (GPX1) gene is associated with tumour progression. The present study aimed to explore the role of GPX1 in 1,25D3-mediated progression of salivary adenoid cystic
Yongmin Yan et al.
Molecular therapy : the journal of the American Society of Gene Therapy, 25(2), 465-479 (2017-01-17)
Exosomes are small biological membrane vesicles secreted by various cells, including mesenchymal stem cells (MSCs). We previously reported that MSC-derived exosomes (MSC-Ex) can elicit hepatoprotective effects against toxicant-induced injury. However, the success of MSC-Ex-based therapy for treatment of liver diseases
Yukari Nakano et al.
Metallomics : integrated biometal science, 12(11), 1693-1701 (2020-09-15)
Excessive zinc ion (Zn2+) release is induced in pathological situations and causes neuronal cell death. Previously, we have reported that copper ions (Cu2+) markedly exacerbated Zn2+-induced neuronal cell death by potentiating oxidative stress, the endoplasmic reticulum (ER) stress response, and
Xiangfeng Gan et al.
International journal of clinical and experimental medicine, 7(9), 2530-2540 (2014-10-31)
Esophageal cancer is one of the most common cancers worldwide. Despite recent progress in the development of novel therapies, esophageal carcinoma remains an aggressive cancer associated with a poor prognosis. The glutathione peroxidase 1 (GPX1) gene located on chromosome 3p21.3
Sui Peng et al.
American journal of physiology. Gastrointestinal and liver physiology, 307(2), G129-G139 (2014-05-24)
Hydrophobic bile acids like deoxycholic acid (DCA), which cause oxidative DNA damage and activate NF-κB in Barrett's metaplasia, might contribute to carcinogenesis in Barrett's esophagus. We have explored mechanisms whereby ursodeoxycholic acid (UDCA, a hydrophilic bile acid) protects against DCA-induced

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.