설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GGGCTTGTGATGGCTACAATGGCTCCTAGACACTCAACGACTTCATCTGTGGCAGGGAGAGAGGAGGCCGGAAGAACAACCCCTGAACAATGGAGGCCTTTCTTTCCCGCTAGGCTCCCAGCCTCCTTCCCGCTACAGAATCGCTCATCGGCGAGGCTCAGCAGAAAGACCCTGAAGGCAGGCTGCAAATGACCCAGAAGAGGGACCTGGGAGTCCTGGTGGGGACGGGGAGGGAGTCTCAATACTCCTTTGCAGTGCAAGGTACTCTGAGTCCCCTCTGTAGTGCCTCTGCCAGACACACACTGCCTGAGTTGAAGAGACACAGGCCACACA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... GPR17(2840) , GPR17(2840)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Simona Cosentino et al.
Journal of cellular and molecular medicine, 18(9), 1785-1796 (2014-06-10)
GPR17 is a G(i) -coupled dual receptor activated by uracil-nucleotides and cysteinyl-leukotrienes. These mediators are massively released into hypoxic tissues. In the normal heart, GPR17 expression has been reported. By contrast, its role in myocardial ischaemia has not yet been
Zhangfu Wang et al.
International immunopharmacology, 88, 106870-106870 (2020-08-18)
Osteoarthritis (OA) is a common joint disease affecting millions of elderly people worldwide. However, the mechanism of OA is complicated and remains poorly understood. Thus, a safe and effective therapeutic strategy has yet to be developed. G protein-coupled receptor 17
Bing Zhao et al.
International journal of molecular medicine, 42(5), 2750-2762 (2018-09-19)
GPR17 is a G (i)-coupled dual receptor, linked to P2Y and CysLT receptors stimulated by uracil nucleotides and cysteinyl leukotrienes, respectively. Recent evidence has demonstrated that GPR17 inhibition ameliorates the progression of cerebral ischemic injury by regulating neuronal death and
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.