설명
Powered by Eupheria Biotech
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
GCAGGTTAAAGCCATTGTGCTAAGATCTAATCTGAGGACACTATAATGGCCCTGTCGTCAGGGAAGCCCGTGATCGCTCGTTTTCAGGGGTCTTACCGGTCAGCAACCTTGGCATTGATACATAGGCACTCTACAGAATTTAAGTTTTCAGAGGTAAGTCTGTTGTTCTGATTAATCTGCATTCATTCAGCGAATGCTCAAGACAAGCCAGGCATGCTGAGAAGCGGCGCTCTAGTTGTATGTAAGATGGGCATTCCTCTGCTCTCCTCTATTCTCCATGTCGACTGAGAAGAGTATAATAAGAACATTGTACCCTCTCCACACTTAACCCTCTGGGATTCTTTATTATAATATAAACCACCGTCGTGAGGCATTTACCTGTTGGATGGAAGGTAGACAGCA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... GAS7(8522) , GAS7(8522)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Kyoko Hanawa-Suetsugu et al.
Nature communications, 10(1), 4763-4763 (2019-10-20)
Phagocytosis is a cellular process for internalization of micron-sized large particles including pathogens. The Bin-Amphiphysin-Rvs167 (BAR) domain proteins, including the FCH-BAR (F-BAR) domain proteins, impose specific morphologies on lipid membranes. Most BAR domain proteins are thought to form membrane invaginations
Douglas Hanniford et al.
Cancer cell, 37(1), 55-70 (2020-01-15)
Metastasis is the primary cause of death of cancer patients. Dissecting mechanisms governing metastatic spread may uncover important tumor biology and/or yield promising therapeutic insights. Here, we investigated the role of circular RNAs (circRNA) in metastasis, using melanoma as a
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.