콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU156721

Sigma-Aldrich

MISSION® esiRNA

targeting human ECM1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CCCTTTGAGGGACAGAGTCAAGTGCAGCCCCCTCCCTCTCAGGAGGCCACCCCTCTCCAACAGGAAAAGCTGCTACCTGCCCAACTCCCTGCTGAAAAGGAAGTGGGTCCCCCTCTCCCTCAGGAAGCTGTCCCCCTCCAAAAAGAGCTGCCCTCTCTCCAGCACCCCAATGAACAGAAGGAAGGAACGCCAGCTCCATTTGGGGACCAGAGCCATCCAGAACCTGAGTCCTGGAATGCAGCCCAGCACTGCCAACAGGACCGGTCCCAAGGGGGCTGGGGCCACCGGCTGGATGGCTTCCCCCCTGGGCGGCCTTCTCCAGACAATCTGAACCAAATCTGCCTTCCTAACCGTCAGCATGTGGTATATGGTCCCTGGAACCTACCACAGTCCAGCTACTCCCACCTCACTCGCCAGGGTGAGACCCTCAATTTCCTGGAGATTGGATATTCCCGCTGCTGCCACTGCCGCAGCCACACAAACCGCCTAGAGT

Ensembl | 인체 수납 번호

ENSG00000143369

NCBI 수납 번호

NM_022664

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... ECM1(1893) , ECM1(1893)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Cuixian Li et al.
PloS one, 6(10), e27053-e27053 (2011-11-03)
Malignant gliomas represent one of the most aggressive types of cancers and their recurrence is closely linked to acquired therapeutic resistance. A combination of chemotherapy is considered a promising therapeutic model in overcoming therapeutic resistance and enhancing treatment efficacy. Herein
Lin-Qing Liu et al.
Food and chemical toxicology : an international journal published for the British Industrial Biological Research Association, 133, 110779-110779 (2019-09-01)
MicroRNAs were known to play very important roles in human diseases, and have attracted great interests of research scientists in medicine, toxicology and functional foods. Gastric carcinoma (GC) remains one of the most common and lethal types of malignancy worldwide.
Sophie Sarah Steinhaeuser et al.
Laboratory investigation; a journal of technical methods and pathology, 100(7), 928-944 (2020-03-24)
The tumor microenvironment is increasingly recognized as key player in cancer progression. Investigating heterotypic interactions between cancer cells and their microenvironment is important for understanding how specific cell types support cancer. Forming the vasculature, endothelial cells (ECs) are a prominent
Jie Chen et al.
Oncogene, 38(14), 2533-2550 (2018-12-12)
Many reports have described DGKα as an oncogene, hence, we investigated its function and the underlying mechanisms in esophageal squamous cell carcinoma (ESCC) progression. This study demonstrated that DGKα was upregulated by inflammatory stimulants and formed feedforward loop with Akt/NF-κB
Ariel E Cariaga-Martínez et al.
Biology open, 3(10), 924-936 (2014-09-14)
The acquisition of invasiveness is characteristic of tumor progression. Numerous genetic changes are associated with metastasis, but the mechanism by which a cell becomes invasive remains unclear. Expression of p85β, a regulatory subunit of phosphoinositide-3-kinase, markedly increases in advanced carcinoma

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.