설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CTGCGAGTTTGCTACCTTCCCTACGGGCAATCGAGAAAGCCAGCTCAATCTCACGGTGATGGCCAAACCCACCAATTGGATAGAGGGTACCCAGGCAGTGCTTCGAGCCAAGAAGGGGCAGGATGACAAGGTCCTGGTGGCCACCTGCACCTCAGCCAATGGGAAGCCTCCCAGTGTGGTATCCTGGGAAACTCGGTTAAAAGGTGAGGCAGAGTACCAGGAGATCCGGAACCCCAATGGCACAGTGACGGTCATCAGCCGCTACCGCCTGGTGCCCAGCAGGGAAGCCCACCAGCAGTCCTTGGCCTGCATCGTCAACTACCACATGGACCGCTTCAAGGAAAGCCTCACTCTCAACGTGCAGTATGAGCCTGAGGTAACCATTGAGGGGTTTGATGGCAACTGGTACCTGCAGCGGATGGACGTGAAGCTCACCTGCAAAGCTGATGCTA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... NECTIN1(5818) , PVRL1(5818)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Joseph C K Leung et al.
Apoptosis : an international journal on programmed cell death, 20(7), 907-920 (2015-03-27)
Glomerulo-podocytic communication plays an important role in the podocytic injury in IgA nephropathy (IgAN). In this study, we examine the role of podocytic angiotensin II receptor subtype 1 (AT1R) and prorenin receptor (PRR) in podocytic apoptosis in IgAN. Polymeric IgA
Feng Y Liu et al.
Journal of the renin-angiotensin-aldosterone system : JRAAS, 15(2), 99-108 (2014-03-05)
Since the discovery of the (pro)renin receptor (PRR), it has been considered as a novel bioactive molecule of the renin-angiotensin system (RAS). The activation of PRR can elicit a series of angiotensin II (AngII)-independent effects. In this study, we investigated
Caixia Li et al.
American journal of physiology. Endocrinology and metabolism, 309(3), E302-E310 (2015-06-18)
High glucose reduces autophagy and enhances apoptosis of podocytes. Previously, we reported that high glucose induced podocyte injury through upregulation of the (pro)renin receptor (PRR). We hypothesized that increasing PRR reduces autophagy and increases apoptosis of mouse podocytes exposed to
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.