콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU151431

Sigma-Aldrich

MISSION® esiRNA

targeting human HSPG2

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

AGTTTGCCTGCCACAGCTACAATGAGTGTGTGGCCCTGGAGTATCGCTGTGACCGGCGGCCCGACTGCAGGGACATGTCTGATGAGCTCAATTGTGAGGAGCCAGTCCTGGGTATCAGCCCCACATTCTCTCTCCTTGTGGAGACGACATCTTTACCGCCCCGGCCAGAGACAACCATCATGCGACAGCCACCAGTCACCCACGCTCCTCAGCCCCTGCTTCCCGGTTCCGTCAGGCCCCTGCCCTGTGGGCCCCAGGAGGCCGCATGCCGCAATGGGCACTGCATCCCCAGAGACTACCTCTGCGACGGACAGGAGGACTGCGAGGACGGCAGCGATGAGCTAGACTGTGGCCCCCCGCCACCCTGTGAGCCCAACGAGTTCCCCTGCGGGAATGGACATTGTGCCCTCAAGCTGTG

Ensembl | 인체 수납 번호

ENSG00000142798

NCBI 수납 번호

NM_005529

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... HSPG2(3339) , HSPG2(3339)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Osama Garwain et al.
Cellular signalling, 71, 109620-109620 (2020-04-05)
Alzheimer's disease is typified by calcium dysfunction and neurofibrillary tangles of tau aggregates along with mitotic proteins. Using PC12 cells as a model system, we determined whether the Gαq/PLCβ/ calcium signaling pathway impacts the manifestation of Alzheimer's disease. Down-regulating PLCβ
Anne M Roesler et al.
Journal of cellular physiology, 234(8), 14187-14197 (2019-01-10)
Airway smooth muscle (ASM) regulation of airway structure and contractility is critical in fetal/neonatal physiology in health and disease. Fetal lungs experience higher Ca2+ environment that may impact extracellular Ca2+ ([Ca2+ ]o ) sensing receptor (CaSR). Well-known in the parathyroid
Cristián Ibarra et al.
Molecular oncology, 13(2), 202-211 (2018-10-26)
Bacillus Calmette-Guérin (BCG) is widely used in the clinic to effectively treat superficial urinary bladder cancer. However, a significant proportion of patients who fail to respond to BCG risk cystectomy or death. Though more than 3 million cancer treatments with
Jeanne L Theis et al.
eLife, 9 (2020-10-03)
Congenital heart diseases (CHDs), including hypoplastic left heart syndrome (HLHS), are genetically complex and poorly understood. Here, a multidisciplinary platform was established to functionally evaluate novel CHD gene candidates, based on whole-genome and iPSC RNA sequencing of a HLHS family-trio.

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.