콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU149811

Sigma-Aldrich

MISSION® esiRNA

targeting human IGFBP5

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

AGTGTGGGCTTTTTCCCTTTTTTGCTCCTTTTCATTACCCCTCCTCCGTTTTCACCCTTCTCCGGACTTCGCGTAGAACCTGCGAATTTCGAAGAGGAGGTGGCAAAGTGGGAGAAAAGAGGTGTTAGGGTTTGGGGTTTTTTTGTTTTTGTTTTTGTTTTTTAATTTCTTGATTTCAACATTTTCTCCCACCCTCTCGGCTGCAGCCAACGCCTCTTACCTGTTCTGCGGCGCCGCGCACCGCTGGCAGCTGAGGGTTAGAAAGCGGGGTGTATTTTAGATTTTAAGCAAAAATTTTAAAGATAAATCCATTTTTCTCTCCCACCCCCAACGCCATCTCCACTGCATCCGATCTCATTATTTCGGTGGTTGCTTGGGGGTGAACAATTTTGTGGCTTTTTTTCCCCTATAATTCTGACCCGCTCAGGCTTGAGGGTTTCTCCGGCCTCCGCTCACTGCGTGCACCTGGCGCTGCCCTGCTTCCCCCAACCTGTTGCAAGGCTTTAATTCTTGCAACTGGGACCTG

Ensembl | 인체 수납 번호

ENSG00000115461

NCBI 수납 번호

NM_000599

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... IGFBP5(3488) , IGFBP5(3488)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Younghay Lee et al.
Cells, 8(4) (2019-04-26)
Type 2 diabetes mellitus (T2DM) is a prevalent chronic metabolic disorder accompanied by high blood glucose, insulin resistance, and relative insulin deficiency. Endoplasmic reticulum (ER) stress induced by high glucose and free fatty acids has been suggested as one of
Dong Hyup Lee et al.
The Korean journal of physiology & pharmacology : official journal of the Korean Physiological Society and the Korean Society of Pharmacology, 17(2), 157-162 (2013-04-30)
Insulin-like growth factor binding proteins (IGFBPs) are important components of insulin growth factor (IGF) signaling pathways. One of the binding proteins, IGFBP-5, enhances the actions of IGF-1, which include the enhanced proliferation of smooth muscle cells. In the present study
Bong-Ki Hong et al.
Experimental & molecular medicine, 49(8), e363-e363 (2017-08-05)
Fibroblast-like synoviocytes (FLSs) constitute a major cell subset of rheumatoid arthritis (RA) synovia. Dysregulation of microRNAs (miRNAs) has been implicated in activation and proliferation of RA-FLSs. However, the functional association of various miRNAs with their targets that are characteristic of
Junyun Wang et al.
Oncotarget, 6(24), 20636-20649 (2015-05-27)
The insulin-like growth factor binding protein 5 (IGFBP5), which is often dysregulated in human cancers, plays a crucial role in carcinogenesis and cancer development. However, the function and underlying mechanism of IGFBP5 in tumor growth and metastasis has been elusive
Wenyu Wang et al.
Molecular cancer therapeutics, 17(9), 1973-1983 (2018-06-22)
Despite showing promise against PIK3CA-mutant breast cancers in preclinical studies, PI3K/AKT pathway inhibitors demonstrate limited clinical efficacy as monotherapy. Here, we found that histone H3K27me3 demethylase KDM6B-targeted IGFBP5 expression provides a protective mechanism for PI3K/AKT inhibitor-induced apoptosis in breast cancer

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.