추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TTGCTGCATATTTCCTGCTGGTCATTGGCGTTGGCTTGTGGTCCATGTGCAGAACCAACAGAGGCACTGTGGGCGGCTACTTCCTGGCAGGACGCAGCATGGTGTGGTGGCCGGTTGGGGCCTCTCTCTTCGCCAGCAACATCGGCAGTGGCCACTTTGTGGGCCTGGCAGGGACTGGCGCTGCAAGTGGCTTGGCTGTTGCTGGATTCGAGTGGAATGCGCTCTTCGTGGTGCTGCTACTGGGCTGGCTGTTTGCACCCGTGTACCTGACAGCGGGGGTCATCACGATGCCACAGTACCTGCGCAAGCGCTTCGGCGGCCGCCGCATCCGCCTCTACCTGTCTGTGCTCTCCCTTTTCCTGTACATCTTCACCAAGATCTCAGTGGACATGTTCTCCGGAGCTGTATTCATCCAGCAGGCTCTGGGCTGGAACATCTA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... SLC5A2(6524) , SLC5A2(6524)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
H Ida-Yonemochi et al.
Journal of dental research, 99(8), 977-986 (2020-04-30)
Glucose is an essential source of energy for mammalian cells and is transported into the cells by glucose transporters. There are 2 types of glucose transporters: one is a passive glucose transporter, GLUT (SLC2A), and the other is a sodium-dependent
Jinpeng Li et al.
JCI insight, 5(6) (2020-03-07)
Sodium glucose cotransporter 2 (SGLT2) inhibitors are beneficial in halting diabetic kidney disease; however, the complete mechanisms have not yet been elucidated. The epithelial-mesenchymal transition (EMT) is associated with the suppression of sirtuin 3 (Sirt3) and aberrant glycolysis. Here, we
Jin Hee Kim et al.
Diabetes, obesity & metabolism, 22(3), 373-382 (2019-11-07)
To investigate the effect of dapagliflozin, a sodium-glucose co-transporter-2 (SGLT2) inhibitor, on renal gluconeogenesis in vitro, ex vivo and in vivo. We treated HK-2 cells (human renal proximal tubule cells) and mouse primary renal proximal tubule cells with dapagliflozin, and
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.