콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU147091

Sigma-Aldrich

MISSION® esiRNA

targeting human CDK5

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

ATGGTGACCTCGATCCTGAGATTGTAAAGTCATTCCTCTTCCAGCTACTAAAAGGGCTGGGATTCTGTCATAGCCGCAATGTGCTACACAGGGACCTGAAGCCCCAGAACCTGCTAATAAACAGGAATGGGGAGCTGAAATTGGCTGATTTTGGCCTGGCTCGAGCCTTTGGGATTCCCGTCCGCTGTTACTCAGCTGAGGTGGTCACACTGTGGTACCGCCCACCGGATGTCCTCTTTGGGGCCAAGCTGTACTCCACGTCCATCGACATGTGGTCAGCCGGCTGCATCTTTGCAGAGCTGGCCAATGCTGGGCGGCCTCTTTTTCCCGGCAATGATGTCGATGACCACTTGATCCTTGACTCCGTGGACACACTGCTGGGGACGCCCACCGAGGAGCAGTGGCCCTCTATGAC

Ensembl | 인체 수납 번호

ENSG00000164885

NCBI 수납 번호

NM_004935

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... CDK5(1020) , CDK5(1020)

관련 카테고리

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jie Zeng et al.
Journal of Cancer, 9(21), 3950-3961 (2018-11-10)
Cyclin-dependent kinase 5 (CDK5), an atypical member of the cyclin-dependent kinase family, plays an important role in the nervous system. Recent studies have shown that CDK5 is also associated with tumors. However, few studies have been done to investigate the
Hailong Tang et al.
International journal of molecular medicine, 45(6), 1661-1672 (2020-04-03)
The emergence of new drugs is a major feature of the treatment history of multiple myeloma (MM), which also reflects the current incurability of MM. As a unique member of cyclin dependent kinase (CDK) family, CDK5 participates in numerous tumorigenic
Johanna Liebl et al.
Nature communications, 6, 7274-7274 (2015-06-02)
The lymphatic system maintains tissue fluid balance, and dysfunction of lymphatic vessels and valves causes human lymphedema syndromes. Yet, our knowledge of the molecular mechanisms underlying lymphatic vessel development is still limited. Here, we show that cyclin-dependent kinase 5 (Cdk5)
Julia Lindqvist et al.
Molecular biology of the cell, 26(11), 1971-1984 (2015-04-09)
Contrary to cell cycle-associated cyclin-dependent kinases, CDK5 is best known for its regulation of signaling processes in differentiated cells and its destructive activation in Alzheimer's disease. Recently, CDK5 has been implicated in a number of different cancers, but how it
Shu Zhang et al.
PloS one, 10(7), e0131833-e0131833 (2015-07-07)
Cyclin-dependent kinase 5 (CDK5) is a cytoplasmic serine/ threonine kinase. Knockdown of CDK5 enhances paclitaxel sensitivity in human ovarian cancer cells. This study explores the mechanisms by which CDK5 regulates paclitaxel sensitivity in human ovarian cancers. Multiple ovarian cancer cell

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.