콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU145931

Sigma-Aldrich

MISSION® esiRNA

targeting human MARVELD2

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GGTTGCTGGATTAGCTTGGATCACCACCATTATTATTCTGGTTCTTGGCATGTCCATGTATTACCGGACCATTCTTCTGGACTCTAATTGGTGGCCCCTAACTGAATTTGGAATTAACGTTGCCTTGTTTATTTTGTATATGGCCGCAGCCATAGTCTATGTGAATGATACCAACCGAGGTGGCCTCTGCTACTATCCGTTATTTAATACACCAGTGAATGCAGTGTTCTGCCGGGTAGAAGGAGGACAGATAGCTGCAATGATCTTCCTGTTTGTCACCATGATAGTTTATCTCATTAGTGCTTTGGTTTGCCTAAAGTTATGGAGGCATGAGGCAGCTCGGAGACATAGAGAATATATGGAACAACAGGAGATAAATGAGCCATCATTGTCATCGAAAAGGAAAATGTGTGAAATGGCC

Ensembl | 인체 수납 번호

ENSG00000152939

NCBI 수납 번호

NM_001038603

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... MARVELD2(153562) , MARVELD2(153562)

관련 카테고리

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Timothy Smyth et al.
Particle and fibre toxicology, 17(1), 52-52 (2020-10-17)
While exposure to diesel exhaust particles has been linked to aberrant immune responses in allergic diseases such as asthma, little attention has been paid to their effects on the airway epithelial barrier. In this study, we sought to determine the
Lawrence C S Tam et al.
Scientific reports, 7, 40717-40717 (2017-01-17)
The juxtacanalicular connective tissue of the trabecular meshwork together with inner wall endothelium of Schlemm's canal (SC) provide the bulk of resistance to aqueous outflow from the anterior chamber. Endothelial cells lining SC elaborate tight junctions (TJs), down-regulation of which
Susanne M Krug
Annals of the New York Academy of Sciences, 1397(1), 219-230 (2017-06-13)
The tricellular tight junction (tTJ) is a potential weak point of the paracellular barrier. For solving the proportional contribution of the tTJ, ion conductances and macromolecule permeabilities were analyzed in cell lines of different leakiness. MDCK II, Caco-2, and HT-29/B6
S M Krug et al.
Mucosal immunology, 11(2), 345-356 (2017-06-15)
In the two inflammatory bowel diseases, ulcerative colitis (UC) and Crohn's disease (CD), altered expression of tight junction (TJ) proteins leads to an impaired epithelial barrier including increased uptake of luminal antigens supporting the inflammation. Here, we focused on regulation
Paul S Cassidy et al.
Molecular therapy. Methods & clinical development, 20, 86-94 (2020-12-31)
Systemic or localized application of glucocorticoids (GCs) can lead to iatrogenic ocular hypertension, which is a leading cause of secondary open-angle glaucoma and visual impairment. Previous work has shown that dexamethasone increases zonula occludens-1 (ZO-1) protein expression in trabecular meshwork

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.