콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU145401

Sigma-Aldrich

MISSION® esiRNA

targeting human PGAM5

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GCAGGAGGAGGACAGTTACGAGATCTTCATCTGTCACGCCAACGTCATCCGCTACATCGTGTGCAGCATCCCGCCGCTGTTGTCCGCTGGGGATTTTGTGCTTCTGGGGTCCTGACCTCTTTCACTTGCTGATCTGTGGGCGCTCCCACCCGTGTGCCAGCGTGACGGCTCGGGGTGTCCGCTCCCCTCTGGGTCGAGGCCACAGCTGAGTCACGTTGCTGCTCGGGCTGCTCCCTCGGGGGGCCCTTGTCCCTCAACCTGCTCTGGTGCCCCACTCTCAGCACCACAGAATGATCCGGGTTCAGGTTGCGTTTTCCCTGCCACCACCCTGCAATCAGCCACTTCTTTAAGGAGCTCCAGGGCTGCAGCCACGTTAGAGGGCCCCTTGGGGGGCAGGGCCAGCTCTACGGTTACATGCCTGAAACAGTCAGAAGGGTTGGCCAAATCTC

Ensembl | 인체 수납 번호

ENSG00000176894

NCBI 수납 번호

NM_018663

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... PGAM5(192111) , PGAM5(192111)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
ZSU
IMU
DOR

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jeong-Min Hong et al.
Life sciences, 200, 94-104 (2018-03-11)
Heme oxygenase-1 (HO-1), an endogenous cytoprotective enzyme, is reported that can be localized in mitochondria under stress, contributing to preserve mitochondrial function. Mitochondrial quality control (QC) is essential to cellular health and recovery linked with redox homeostasis. Recent studies reported
Yuhua Chen et al.
Antioxidants & redox signaling, 34(2), 154-170 (2020-04-08)
Aims: Traumatic brain injury (TBI) is a major cause of disability and death, and a better understanding of the underlying mechanisms of mitochondrial dysfunction will provide important targets for preventing damage from neuronal insults. Phosphoglycerate mutase 5 (PGAM5) is localized
Wei Zuo et al.
European journal of pharmacology, 880, 173143-173143 (2020-05-04)
Growing evidence have suggested that mitophagy could exert a neuroprotective role in brain ischemia by removing the damaged mitochondria. However the upstream mechanisms of mitophagy are remain unclear. We previously observed a decrease of miR-330 in a miRNA profile of
Chen Yang et al.
In vitro cellular & developmental biology. Animal, 53(3), 248-257 (2016-11-07)
Phosphoglycerate mutase 5 (PGAM5) is a mitochondrial membrane protein that plays crucial roles in necroptosis and apoptosis. Though PGAM5 is known to be required for inducing intrinsic apoptosis through interacting with BCL2 associated X protein (Bax) and dynamin-related protein 1
Wei Lu et al.
Nature communications, 5, 4930-4930 (2014-09-16)
Mitophagy is a specialized form of autophagy that selectively disposes of dysfunctional mitochondria. Delineating the molecular regulation of mitophagy is of great importance because defects in this process lead to a variety of mitochondrial diseases. Here we report that mice

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.