콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU145171

Sigma-Aldrich

MISSION® esiRNA

targeting human IL10

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TGCCTTCAGCAGAGTGAAGACTTTCTTTCAAATGAAGGATCAGCTGGACAACTTGTTGTTAAAGGAGTCCTTGCTGGAGGACTTTAAGGGTTACCTGGGTTGCCAAGCCTTGTCTGAGATGATCCAGTTTTACCTGGAGGAGGTGATGCCCCAAGCTGAGAACCAAGACCCAGACATCAAGGCGCATGTGAACTCCCTGGGGGAGAACCTGAAGACCCTCAGGCTGAGGCTACGGCGCTGTCATCGATTTCTTCCCTGTGAAAACAAGAGCAAGGCCGTGGAGCAGGTGAAGAATGCCTTTAATAAGCTCCAAGAGAAAGGCATCTACAAAGCCATGAGTGAGTTTGACATCTTCATCAACTACATAGAAGCCTACATGACAATGAAGATACGAAACTGAGACATCAGGGTGGC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Hyeon-Soo Lee et al.
Journal of cellular and molecular medicine, 19(7), 1538-1547 (2015-06-11)
Although the mechanisms by which hyperoxia promotes bronchopulmonary dysplasia are not fully defined, the inability to maintain optimal interleukin (IL)-10 levels in response to injury secondary to hyperoxia seems to play an important role. We previously defined that hyperoxia decreased
Sandip Mukherjee et al.
Journal of immunology (Baltimore, Md. : 1950), 193(8), 4083-4094 (2014-09-14)
The efflux of antimony through multidrug resistance protein (MDR)-1 is the key factor in the failure of metalloid treatment in kala-azar patients infected with antimony-resistant Leishmania donovani (Sb(R)LD). Previously we showed that MDR-1 upregulation in Sb(R)LD infection is IL-10-dependent. Imipramine
Rodrigo Liberal et al.
Hepatology (Baltimore, Md.), 62(3), 863-875 (2015-05-09)
Defective immune regulation plays a permissive role enabling effector cells to initiate and perpetuate tissue damage, eventually resulting in autoimmune disease. Numerical and functional regulatory T-cell (Treg) impairment has been previously reported in autoimmune liver disease (AILD; including autoimmune hepatitis

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.