설명
Powered by Eupheria Biotech
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
TGCCTTCAGCAGAGTGAAGACTTTCTTTCAAATGAAGGATCAGCTGGACAACTTGTTGTTAAAGGAGTCCTTGCTGGAGGACTTTAAGGGTTACCTGGGTTGCCAAGCCTTGTCTGAGATGATCCAGTTTTACCTGGAGGAGGTGATGCCCCAAGCTGAGAACCAAGACCCAGACATCAAGGCGCATGTGAACTCCCTGGGGGAGAACCTGAAGACCCTCAGGCTGAGGCTACGGCGCTGTCATCGATTTCTTCCCTGTGAAAACAAGAGCAAGGCCGTGGAGCAGGTGAAGAATGCCTTTAATAAGCTCCAAGAGAAAGGCATCTACAAAGCCATGAGTGAGTTTGACATCTTCATCAACTACATAGAAGCCTACATGACAATGAAGATACGAAACTGAGACATCAGGGTGGC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... IL10(3586) , IL10(3586)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Journal of cellular and molecular medicine, 19(7), 1538-1547 (2015-06-11)
Although the mechanisms by which hyperoxia promotes bronchopulmonary dysplasia are not fully defined, the inability to maintain optimal interleukin (IL)-10 levels in response to injury secondary to hyperoxia seems to play an important role. We previously defined that hyperoxia decreased
Journal of immunology (Baltimore, Md. : 1950), 193(8), 4083-4094 (2014-09-14)
The efflux of antimony through multidrug resistance protein (MDR)-1 is the key factor in the failure of metalloid treatment in kala-azar patients infected with antimony-resistant Leishmania donovani (Sb(R)LD). Previously we showed that MDR-1 upregulation in Sb(R)LD infection is IL-10-dependent. Imipramine
Hepatology (Baltimore, Md.), 62(3), 863-875 (2015-05-09)
Defective immune regulation plays a permissive role enabling effector cells to initiate and perpetuate tissue damage, eventually resulting in autoimmune disease. Numerical and functional regulatory T-cell (Treg) impairment has been previously reported in autoimmune liver disease (AILD; including autoimmune hepatitis
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.