설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CACCATTGGCTTCATGTTTGCATGCGTTGGCAGGGGCTTTCAGTATTACAGAGCCAAGGGGAATGTTGAGGCTGATGCATTTAGAAAGTTTTTTCCTAGTGTTCCCTTATTCGGCTTCTTTGGAAATGGAGAAATTGGATGTGATCGGATAGTCACTGGGAACTTTATATTGAGGAAATGTAATGAGGTAAAAGATGATGATCTGTTTCATAGCTATACAACAATAATGGCACTCATACATCTGGGGTCATCTAAATAATAATTAAAGTGGCTTTCATAATATGTAACTTTTGGGTTCTGCCTTTTTCAGAAAATGGAAACTTGGGCCATGTGTATTTCAAACAAAAATAACTTTAGATATATCTTTTTTGTAGCTTTGATTGATGCTCTAAGATCACATGAGGGTAGTATTTAATATATTAGATGAAGGACAACTTTGGACATAACACTGACTAGGAGTTGAGAGCTTTTGCATCAGGCAGAAGCAAACTG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... FBXO22(26263) , FBXO22(26263)
관련 카테고리
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Xun-Kai Hou et al.
Biochemical and biophysical research communications, 523(3), 766-772 (2020-01-18)
Long noncoding RNA small nucleolus RNA host gene 14 (SNHG14) has been shown to exert oncogenic functions in seceral cancers, but its role in osteosarcoma still unclear. In this present study, we found that SNHG14 was significantly upregulated in osteosarcoma
Feng Guo et al.
International journal of biological sciences, 15(3), 647-656 (2019-02-13)
F-box only protein 22 (FBXO22), a substrate receptor of the SKP1-Cullin 1-F-box protein (SCF) E3 ubiquitin ligase that targets key regulators of cellular activities for ubiquitylation and degradation, plays important roles in the progression of human cancer. However, little is
Long Zhang et al.
Journal of experimental & clinical cancer research : CR, 38(1), 101-101 (2019-02-28)
Deregulation of ubiquitin ligases is related to the malignant progression of human cancers. F-box only protein 22 (FBXO22), an F-box E3 ligase, is a member of the F-box protein family. However, the biological function of FBXO22 in HCC and the
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.