설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ATCGAGTGTTTGGCCACAGTTCGGGACCTATGGTAGAAAAATACTCAGTAGCTACCCAGATTGTAATGGGTGGCGTTACTGGCTGGTGTGCAGGATTTCTGTTCCAGAAAGTTGGAAAACTTGCAGCAACTGCAGTAGGTGGTGGCTTTCTTCTTCTTCAGATTGCTAGTCATAGTGGCTATGTGCAGATTGACTGGAAGAGAGTTGAAAAAGATGTAAATAAAGCAAAAAGACAGATTAAGAAACGAGCGAACAAAGCAGCACCTGAAATCAACAATTTAATTGAAGAAGCAACAGAATTTATCAAGCAGAACATTGTGATATCCAGTGGATTTGTGGGAGGCTTTTTGCTCGGACTTGCATCTTAAGGACATGAATATTCTCCCATAACGGATTCAACTATGAGAAGAGAAGTGGCAGCAATAAGGCAGT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... FUNDC1(139341) , FUNDC1(139341)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
L Hui et al.
Clinical & translational oncology : official publication of the Federation of Spanish Oncology Societies and of the National Cancer Institute of Mexico, 21(5), 596-606 (2018-10-05)
The purpose of our study was to investigate an underlying mechanism that hydrogen peroxide-induced mitophagy contributed to laryngeal cancer cells survivals under oxidative stress condition. Tumor tissue and serum samples were collected from patients with laryngeal cancer. The Hep2 cell
Hao Zhou et al.
Basic research in cardiology, 113(4), 23-23 (2018-05-11)
Mitochondrial fission and mitophagy are considered key processes involved in the pathogenesis of cardiac microvascular ischemia reperfusion (IR) injury although the upstream regulatory mechanism for fission and mitophagy still remains unclear. Herein, we reported that NR4A1 was significantly upregulated following
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.