콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU137391

Sigma-Aldrich

MISSION® esiRNA

targeting human RECQL4

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TACGGCTCAACATGAAGCAGAAACACTACGTGCGGGGCCGGGCACTCCGTAGCAGGCTCCTCCGCAAGCAGGCATGGAAGCAGAAGTGGCGGAAGAAAGGGGAGTGTTTTGGGGGTGGTGGTGCCACAGTCACAACCAAGGAGTCTTGTTTCCTGAACGAGCAGTTCGATCACTGGGCAGCCCAGTGTCCCCGGCCAGCAAGTGAGGAAGACACAGATGCTGTTGGGCCTGAGCCACTGGTTCCTTCACCACAACCTGTACCTGAGGTGCCCAGCCTGGACCCCACCGTGCTGCCACTCTACTCCCTGGGGCCCTCAGGGCAGTTGGCAGAGACGCCGGCTGAGGTGTTCCAGGCCCTGGAGCAGCTGGGGCACCAAGCCTTTCGCCCTGGGCAGGAGCGTGCAGTCATGCGGATCCTGTCTGGCATCTCCAC

Ensembl | 인체 수납 번호

ENSG00000160957

NCBI 수납 번호

NM_004260

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... RECQL4(9401) , RECQL4(9401)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Alvin J M Ng et al.
PLoS genetics, 11(4), e1005160-e1005160 (2015-04-11)
RECQL4 mutations are associated with Rothmund Thomson Syndrome (RTS), RAPADILINO Syndrome and Baller-Gerold Syndrome. These patients display a range of benign skeletal abnormalities such as low bone mass. In addition, RTS patients have a highly increased incidence of osteosarcoma (OS).
Guosheng Lyu et al.
Cancer biology & medicine, 18(1), 120-138 (2021-02-26)
RECQL4 (a member of the RECQ helicase family) upregulation has been reported to be associated with tumor progression in several malignancies. However, whether RECQL4 sustains esophageal squamous cell carcinoma (ESCC) has not been elucidated. In this study, we determined the
Chen Qiao et al.
Oncotarget, 7(13), 17009-17020 (2016-03-10)
Oroxylin A is a flavonoid extracted from the root of Scutellaria baicalensis Georgi. We previously demonstrated that oroxylin A induced apoptosis in human colon cancer cells via the mitochondrial pathway. In the present study, we investigated the underlying mechanisms responsible
Ying Wai Chan et al.
Nature cell biology, 20(1), 92-103 (2017-12-20)
The resolution of joint molecules that link recombining sister chromatids is essential for chromosome segregation. Here, we determine the fate of unresolved recombination intermediates arising in cells lacking two nucleases required for resolution (GEN1 -/- knockout cells depleted of MUS81).

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.