콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU137321

Sigma-Aldrich

MISSION® esiRNA

targeting human TBX21

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

AGGATGTTTGTGGACGTGGTCTTGGTGGACCAGCACCACTGGCGGTACCAGAGCGGCAAGTGGGTGCAGTGTGGAAAGGCCGAGGGCAGCATGCCAGGAAACCGCCTGTACGTCCACCCGGACTCCCCCAACACAGGAGCGCACTGGATGCGCCAGGAAGTTTCATTTGGGAAACTAAAGCTCACAAACAACAAGGGGGCGTCCAACAATGTGACCCAGATGATTGTGCTCCAGTCCCTCCATAAGTACCAGCCCCGGCTGCATATCGTTGAGGTGAACGACGGAGAGCCAGAGGCAGCCTGCAACGCTTCCAACACGCATATCTTTACTTTCCAAGAAACCCAGTTCATTGCCGTGACTGCCTACCAGAATGCCGAGATTACTCAGCTGAAAATTGATAATAACCCCTTTGCCAAAGGATTCCGGGAGAACT

Ensembl | 인체 수납 번호

ENSG00000073861

NCBI 수납 번호

NM_013351

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... TBX21(30009) , TBX21(30009)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Huiyong Peng et al.
Journal of immunology research, 2020, 6401978-6401978 (2020-05-08)
Long noncoding RNAs (lncRNAs) have been increasingly recognized as key immune molecules that participate in the pathogenesis of autoimmune diseases. Previous studies have demonstrated that the lncRNA Ifng-AS1, a key scaffold that contributes to the transcription of IFN-γ, depends on
Shigen Hayashi et al.
American journal of respiratory cell and molecular biology, 61(4), 525-536 (2019-04-10)
Chronic obstructive pulmonary disease (COPD) is a progressive lung disease characterized by peripheral airways inflammation and emphysema. Emerging evidence indicates a contribution of both innate and adaptive immune cells to the development of COPD. Transcription factor T-bet modulates the function
Wenjing Yi et al.
Immunology, 150(3), 301-311 (2016-11-04)
Hepatitis C virus (HCV) induces a high rate of chronic infection via dysregulation of host immunity. We have previously shown that T-cell immunoglobulin and mucin domain protein-3 (Tim-3) is up-regulated on monocyte/macrophages (M/Mφ) during chronic HCV infection; little is known
Jason S Weinstein et al.
The Journal of experimental medicine, 215(1), 337-355 (2017-12-08)
Follicular helper T (Tfh) cells promote germinal center (GC) B cell survival and proliferation and guide their differentiation and immunoglobulin isotype switching by delivering contact-dependent and soluble factors, including IL-21, IL-4, IL-9, and IFN-γ. IL-21 and IFN-γ are coexpressed by

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.