설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GGAGCAGCGAGACTTTCAACAGTTTCCTGCGTCGGGCACAACAGGAGACACAGCAGGTCCCCACAGAGGAAGTGTCCTTGGAAGTGCTGCTCAGCAACGGGCAGAAAGTTCTGGTCAACGTGCTAACTTCAGATCAGACTGAGGATGTCCTGGAGGCTGTAGCTGCAAAGCTGGATCTTCCAGATGACTTGATTGGATACTTTAGTCTATTCTTAGTTCGAGAAAAAGAGGATGGAGCCTTTTCTTTTGTACGGAAGTTGCAAGAGTTTGAGCTGCCTTATGTGTCTGTCACCAGCCTTCGGAGTCAAGAGTATAAGATTGTGCTAAGGAAGAGTTATTGGGACTCTGCCTATGATGACGATGTCATGGAGAACCGGGTTGGCCTGAACCTGCTTTATGCTCAGACGGTATCAGATATTGAGCGTGGGTGGAT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... SNX17(9784) , SNX17(9784)
관련 카테고리
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
David Pim et al.
Journal of virology, 95(3) (2020-11-13)
Previous studies have identified an interaction between the human papillomavirus (HPV) L2 minor capsid protein and sorting nexins 17 and 27 (SNX17 and SNX27) during virus infection. Further studies show the involvement of both retromer and retriever complexes in this
Fuyao Liu et al.
Cell reports, 32(7), 108049-108049 (2020-08-20)
APC mutation activation of Wnt/β-catenin drives initiation of colorectal carcinogenesis (CRC). Additional factors potentiate β-catenin activation to promote CRC. Western diets are enriched in linoleic acid (LA); LA-enriched diets promote chemically induced CRC in rodents. 15-Lipoxygenase-1 (15-LOX-1), the main LA-metabolizing
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.