콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU136981

Sigma-Aldrich

MISSION® esiRNA

targeting human HDAC4

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

AGAAGCAGCAGATCCAGAGGCAGATCCTCATCGCTGAGTTCCAGAGGCAGCACGAGCAGCTCTCCCGGCAGCACGAGGCGCAGCTCCACGAGCACATCAAGCAACAACAGGAGATGCTGGCCATGAAGCACCAGCAGGAGCTGCTGGAACACCAGCGGAAGCTGGAGAGGCACCGCCAGGAGCAGGAGCTGGAGAAGCAGCACCGGGAGCAGAAGCTGCAGCAGCTCAAGAACAAGGAGAAGGGCAAAGAGAGTGCCGTGGCCAGCACAGAAGTGAAGATGAAGTTACAAGAATTTGTCCTCAATAAAAAGAAGGCGCTGGCCCACCGGAATCTGAACCACTGCATTTCCAGCGACCCTCGCTACTGGTACGGGAAAACGCAGCACAGTTCCCTTGACCAGAGTTCTCCACCCCAGAGCGGAGTGTCGACCTCCTATAACCACCCGGTCCTGGGAATGTACGACGCCAAAGATGACTTCCCTCTTAGGAAAACAGCTTCTGAACCGAATCTGAAATTACGGTCCAGGC

Ensembl | 인체 수납 번호

ENSG00000068024

NCBI 수납 번호

NM_006037

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... HDAC4(9759) , HDAC4(9759)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Todd J Cohen et al.
Molecules and cells, 38(4), 343-348 (2015-03-03)
Fiber type-specific programs controlled by the transcription factor MEF2 dictate muscle functionality. Here, we show that HDAC4, a potent MEF2 inhibitor, is predominantly localized to the nuclei in fast/glycolytic fibers in contrast to the sarcoplasm in slow/oxidative fibers. The cytoplasmic
Ling X Zhang et al.
American journal of physiology. Cell physiology, 307(4), C358-C372 (2014-06-20)
We have recently shown that in vivo inhibition of histone deacetylase (HDAC) stimulates endogenous myocardial regeneration in infarcted hearts (Zhang L et al. J Pharmacol Exp Ther 341: 285-293, 2012). Furthermore, our observation demonstrates that HDAC inhibition promotes cardiogenesis, which
GuoLiang Zou et al.
Biochimie, 165, 90-99 (2019-05-13)
The cardioprotection of catalpol and its mechanism in diabetic cardiomyopathy (DCM) remains unclear. Here, mouse cardiomyocytes were treated with high glucose (HG) to establish a model of cellular injury induced by HG. In vitro experiments were carried out and confirmed that
Y Yang et al.
Oncogene, 30(19), 2207-2218 (2011-01-19)
The transcriptional activity of the androgen receptor (AR) is regulated by both ligand binding and post-translational modifications, including acetylation and small ubiquitin-like modifier (SUMO)ylation. Histone deacetylases (HDACs) are known to catalyze the removal of acetyl groups from both histones and
Jung-Won Lee et al.
Nature communications, 10(1), 1897-1897 (2019-04-25)
The cellular decision regarding whether to undergo proliferation or death is made at the restriction (R)-point, which is disrupted in nearly all tumors. The identity of the molecular mechanisms that govern the R-point decision is one of the fundamental issues
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.