콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU135151

Sigma-Aldrich

MISSION® esiRNA

targeting human SMARCA2

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

ATCGAGGAAAAGCCAAACCTGTAGTGAGCGATTTTGACAGCGATGAGGAGCAGGATGAACGTGAACAGTCAGAAGGAAGTGGGACGGATGATGAGTGATCAGTATGGACCTTTTTCCTTGGTAGAACTGAATTCCTTCCTCCCCTGTCTCATTTCTACCCAGTGAGTTCATTTGTCATATAGGCACTGGGTTGTTTCTATATCATCATCGTCTATAAACTAGCTTTAGGATAGTGCCAGACAAACATATGATATCATGGTGTAAAAAACACACACATACACAAATATTTGTAACATATTGTGACCAAATGGGCCTCAAAGATTCAGATTGAAACAAACAAAAAGCTTTTGATGGAAAATATGTGGGTGGATAGTATATTTCTATGGGTGGGTCTAATTTGGTAACGGTTTGATTGTGCCTGGTTT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Erika Zernickel et al.
Molecular cancer therapeutics, 18(3), 656-666 (2018-11-28)
Targeting of epigenetic regulators as the chromatin remodeler SWI/SNF is proving to be a promising therapeutic strategy for individualized treatment of cancer patients. Here, we tested whether targeting one of the two mutually exclusive subdomains of the SWI/SNF complex BRM/SMARCA2
Tharu M Fernando et al.
Nature communications, 11(1), 5551-5551 (2020-11-05)
Genomic studies performed in cancer patients and tumor-derived cell lines have identified a high frequency of alterations in components of the mammalian switch/sucrose non-fermentable (mSWI/SNF or BAF) chromatin remodeling complex, including its core catalytic subunit, SMARCA4. Cells exhibiting loss of
Qiong Wu et al.
Journal of cellular physiology, 230(11), 2683-2694 (2015-03-27)
The Brahma (BRM) and Brahma-related Gene 1 (BRG1) ATPases are highly conserved homologs that catalyze the chromatin remodeling functions of the multi-subunit human SWI/SNF chromatin remodeling enzymes in a mutually exclusive manner. SWI/SNF enzyme subunits are mutated or missing in

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.