콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU134631

Sigma-Aldrich

MISSION® esiRNA

targeting human NR1H3

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CCCTTCAGAACCCACAGAGATCCGTCCACAAAAGCGGAAAAAGGGGCCAGCCCCCAAAATGCTGGGGAACGAGCTATGCAGCGTGTGTGGGGACAAGGCCTCGGGCTTCCACTACAATGTTCTGAGCTGCGAGGGCTGCAAGGGATTCTTCCGCCGCAGCGTCATCAAGGGAGCGCACTACATCTGCCACAGTGGCGGCCACTGCCCCATGGACACCTACATGCGTCGCAAGTGCCAGGAGTGTCGGCTTCGCAAATGCCGTCAGGCTGGCATGCGGGAGGAGTGTGTCCTGTCAGAAGAACAGATCCGCCTGAAGAAACTGAAGCGGCAAGAGGAGGAACAGGCTCATGCCACATCCTTGCCCCCCAGGGCTTCCTCACCCCCCCAAATCCTGCCCCAGCTCAGCCCGGAACAACTGGGCATGATCGAGAAG

Ensembl | 인체 수납 번호

ENSG00000025434

NCBI 수납 번호

NM_001130101

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... NR1H3(10062) , NR1H3(10062)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
QCS
NNS
FQR

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Akihiro Shimada et al.
Lipids in health and disease, 15, 57-57 (2016-03-18)
Statins decrease cholesteryl ester transfer protein (CETP) levels, which have been positively associated with hepatic lipid content as well as serum low density lipoproteins-cholesterol (LDL-C) levels. However, the relationship between the CETP status and statin-induced reductions in LDL-C levels has
Claudia Bellomo et al.
Cell death and differentiation, 25(5), 885-903 (2017-12-13)
Understanding the complexity of changes in differentiation and cell survival in hepatocellular carcinoma (HCC) is essential for the design of new diagnostic tools and therapeutic modalities. In this context, we have analyzed the crosstalk between transforming growth factor β (TGFβ)
Jasmin R Agarwal et al.
Molecular cancer therapeutics, 13(7), 1873-1881 (2014-05-09)
The Hedgehog (Hh) signaling pathway is aberrantly activated in a wide variety of human cancers, and recent clinical studies have demonstrated that pathway inhibitors are effective in advanced basal cell carcinoma (BCC). The majority of these agents have been designed
Louise Ménégaut et al.
Cell reports, 31(7), 107665-107665 (2020-05-21)
Low-grade inflammation is constitutive of atherosclerosis, and anti-inflammatory therapy inhibiting interleukin-1β (IL-1β) reduces the rate of cardiovascular events. While cholesterol accumulation in atheroma plaque and macrophages is a major driver of the inflammatory process, the role of the LXR cholesterol
Mengyang Liu et al.
The Journal of biological chemistry, 290(23), 14418-14429 (2015-04-29)
Cholesteryl ester transfer protein (CETP) transfers cholesteryl esters from high density lipoprotein to triglyceride-rich lipoproteins. CETP expression can be transcriptionally activated by liver X receptor (LXR). Etoposide and teniposide are DNA topoisomerase II (Topo II) inhibitors. Etoposide has been reported
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.