설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ACTCAGCCACCTCTGCTGATGAGCAGCCCCACATTGGAAACTACCGGCTCCTCAAGACCATTGGCAAGGGTAATTTTGCCAAGGTGAAGTTGGCCCGACACATCCTGACTGGGAAAGAGGTAGCTGTGAAGATCATTGACAAGACTCAACTGAACTCCTCCAGCCTCCAGAAACTATTCCGCGAAGTAAGAATAATGAAGGTTTTGAATCATCCCAACATAGTTAAATTATTTGAAGTGATTGAGACTGAGAAAACGCTCTACCTTGTCATGGAGTACGCTAGTGGCGGAGAGGTATTTGATTACCTAGTGGCTCATGGCAGGATGAAAGAAAAAGAGGCTCGAGCCAAATTCCGCCAGATAGTGTCTGCTGTGCAGTACTGTCACCAGAAGTTTATTGTCCATAGAGACTTAAAGGCAGAAAACCTGCTCTTGGATGC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... MARK2(2011) , MARK2(2011)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Andrea Zamperone et al.
Cell cycle (Georgetown, Tex.), 18(3), 299-311 (2018-12-26)
The serine/threonine kinase Par1 is a core component of the machinery that sets up polarity in the embryo and regulates cell fate decisions but its role in the homeostasis of adult tissues is poorly understood. Inhibition of Par1 by the
Clément d'Audigier et al.
Angiogenesis, 18(3), 347-359 (2015-06-01)
Endothelial colony forming cells (ECFC) represent a subpopulation of endothelial progenitor cells involved in endothelial repair. The activation of procoagulant mechanisms associated with the vascular wall's inflammatory responses to injury plays a crucial role in the induction and progression of
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.