콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU132581

Sigma-Aldrich

MISSION® esiRNA

targeting human NEDD4

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TCCAGGATGGGAAGAGAGAACTCACACAGATGGAAGAATCTTCTACATAAATCACAATATAAAAAGAACACAATGGGAAGATCCTCGGTTGGAGAATGTAGCAATAACTGGACCAGCAGTGCCCTACTCCAGGGATTACAAAAGAAAGTATGAGTTCTTCCGAAGAAAGTTGAAGAAGCAGAATGACATTCCAAACAAATTTGAAATGAAACTTCGCCGAGCAACTGTTCTTGAAGACTCTTACCGGAGAATTATGGGTGTCAAGAGAGCAGACTTCCTGAAGGCTCGACTGTGGATTGAGTTTGATGGTGAAAAGGGATTGGATTATGGAGGAGTTGCCAGAGAATGGTTCTTCCTGATCTCAAAGGAAATGTTTAACCCTTATTATGGGTTGTTTGAATATTCTGCTACGGACAATTATACCCTACAGATAAATCCAAACTCTGGATTGTGTAACGAAGATCACCTCTCTTACTTCAAGTTTATTGGTCGGGTAGC

Ensembl | 인체 수납 번호

ENSG00000069869

NCBI 수납 번호

NM_006154

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... NEDD4(4734) , NEDD4(4734)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Seon-Ae Jeon et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(12), 14772-14783 (2019-11-07)
E3 ubiquitin ligases are involved in the regulation of oxidative stress-induced cell death. In this study, we investigated the role of neural precursor cell-expressed, developmentally down-regulated protein 4 (NEDD4) in regulation of hydrogen peroxide (H2O2)-induced cell proliferation and apoptosis in
Wu Wen et al.
Cell cycle (Georgetown, Tex.), 16(16), 1509-1514 (2017-07-27)
The neural precursor cell expressed developmentally downregulated protein 4 (NEDD4) plays a pivotal oncogenic role in various types of human cancers. However, the function of NEDD4 in bladder cancer has not been fully investigated. In the present study, we aim to
Shaoyan Feng et al.
Cell cycle (Georgetown, Tex.), 16(9), 869-878 (2017-04-06)
Nasopharyngeal carcinoma (NPC) is a highly invasive head-neck cancer derived from the nasopharyngeal epithelium, mainly prevalent in southern China and Southeast Asia. Radiotherapy and adjuvant cisplatin (DDP) chemotherapy are standard administrations applied in the treatment of NPC. However, resistance to
Qiong Lin et al.
Journal of cell science, 130(22), 3839-3850 (2017-10-13)
Our previous studies have shown that the HECT E3 ubiquitin ligase NEDD4 interacts with LC3 and is required for starvation and rapamycin-induced activation of autophagy. Here, we report that NEDD4 directly binds to SQSTM1 via its HECT domain and polyubiquitylates
Jin Zhang et al.
American journal of translational research, 11(6), 3461-3471 (2019-07-18)
Prostate cancer is the second most common malignancy among men and causes a myriad of health problem for males that are diagnosed with the cancer. Although the 5-year relative survival rate of prostate cancer patients has been significantly increased due
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.