설명
Powered by Eupheria Biotech
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
ACAGCCAGCGCTACAAAGTTGACTACGAGTCTCAGAGCACAGATACCCAGAACTTCTCCTCCGAGTCCAAGCGGGAGACAGAATATGGTCCCTGCCGTAGAGAAATGGAAGACACACTGAATCACCTGAAGTTCCTCAATGTGCTGAGTCCCAGGGGTGTACACATTCCCAACTGTGACAAGAAGGGATTTTATAAGAAAAAGCAGTGTCGCCCTTCCAAAGGCAGGAAGCGGGGCTTCTGCTGGTGTGTGGATAAGTATGGGCAGCCTCTCCCAGGCTACACCACCAAGGGGAAGGAGGACGTGCACTGCTACAGCATGCAGAGCAAGTAGACGCCTGCCGCAAGGTTAATGTGGAGCTCAAATATGCCTTATTTTGCACAAAAGACTGCCAAGGACATGACC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... IGFBP3(3486) , IGFBP3(3486)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 37(11), 15043-15052 (2016-09-24)
Insulin-like growth factor-binding protein-3 (IGFBP3) is an N-linked glycosylated, phosphorylated protein, which has been reported to regulate cancer progression and metastasis. However, the role of IGFBP3 in tumor metastasis remains under debate. Nasopharyngeal carcinoma (NPC) is a highly metastatic head
Oncology reports, 37(2), 1075-1083 (2016-12-22)
MicroRNAs play critical roles in the progression of acute lymphoblastic leukemia (ALL). Previous studies have indicated that miR-196b and miR-1290 play critical roles in T-cell ALL (T-ALL) and B-cell ALL (B-ALL), respectively. Resveratrol, a natural edible polyphenolic phytoalexin, possesses certain
Cancer management and research, 12, 1007-1015 (2020-02-28)
Chemotherapeutic treatment of hepatocellular carcinoma (HCC) has always been plagued by nonspecific and side effects. Plant extracts have potential anticancer capabilities with low cytotoxicity and few side effects, but their detailed mechanisms are still unclear, thus limiting their clinical applications.
Investigative ophthalmology & visual science, 61(11), 33-33 (2020-09-18)
To investigate whether AMP-activated protein kinase (AMPK) is required for the reduction of high mobility group box 1 (HMGB1) by exchange proteins activated by cAMP 1 (Epac1) in the retinal vasculature. We measured AMPK phosphorylation in normal and diabetic Epac1
Journal of molecular and cellular cardiology, 139, 98-112 (2020-01-27)
Salvianolic acid B (Sal B) is the representative component of phenolic acids derived from the dried root and rhizome of Salvia miltiorrhiza Bge. (Labiatae), which has been widely used for the treatment of cardiovascular and cerebrovascular diseases. However, the effect
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.