추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GAAGCTGTGAGCAACATCCACAACCTCAACTCTGTCCACCAGTCGCCACACCAGAGACTGCACCGCTACGTGGAGCTGGCCTGGGGCTTCTCCACTGCCCTGGGCACCTTTCTCTTCCTTGCTGAAGTTGTCCTGGTTGGTTGGGTCAAGTTTGTGCCCATTGGGGCTCCCTTGGACACACCGACCCCCATGGTGCCCACATCCCGGGTGCCCGGGACTCTGGCACCAGTGGCTACCTCCCTTAGTCCAGCTTCCAATCTCCCACGGTCCTCTGCGTCTGCAGCACCGTCCCAAGCTGAGCCAGCCTGCCCACCCCGGCAAGCCTGTGGTGGTGGTGGGGCCCATGGGCCAGGCTGGCAAGCAGCCATGGCCTCCACAGCCATCATGGTACCCGTGGGGCTCGTGTTTGTGGCCTTTGCCCTGCATTTCTACCGCTCCTTGGTGGCACACAAGACAGACCGCTA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... ORAI3(93129) , ORAI3(93129)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Michael A Thompson et al.
American journal of respiratory cell and molecular biology, 51(1), 68-76 (2014-01-30)
Plasma membrane Ca(2+) influx, especially store-operated Ca(2+) entry triggered by sarcoplasmic reticulum (SR) Ca(2+) release, is a key component of intracellular calcium concentration ([Ca(2+)]i) regulation in airway smooth muscle (ASM). Agonist-induced Ca(2+) oscillations in ASM that involve both influx and
Carlos Cantonero et al.
International journal of molecular sciences, 21(9) (2020-05-13)
Arachidonic acid (AA) is a phospholipase A2 metabolite that has been reported to mediate a plethora of cellular mechanisms involved in healthy and pathological states such as platelet aggregation, lymphocyte activation, and tissue inflammation. AA has been described to activate
Jingsheng Xia et al.
The Journal of physiology, 592(16), 3443-3461 (2014-05-27)
Store-operated calcium channels (SOCs) are calcium-selective cation channels that mediate calcium entry in many different cell types. Store-operated calcium entry (SOCE) is involved in various cellular functions. Increasing evidence suggests that impairment of SOCE is responsible for numerous disorders. A
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.