콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU131741

Sigma-Aldrich

MISSION® esiRNA

targeting human ORAI3, AC135048.13

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GAAGCTGTGAGCAACATCCACAACCTCAACTCTGTCCACCAGTCGCCACACCAGAGACTGCACCGCTACGTGGAGCTGGCCTGGGGCTTCTCCACTGCCCTGGGCACCTTTCTCTTCCTTGCTGAAGTTGTCCTGGTTGGTTGGGTCAAGTTTGTGCCCATTGGGGCTCCCTTGGACACACCGACCCCCATGGTGCCCACATCCCGGGTGCCCGGGACTCTGGCACCAGTGGCTACCTCCCTTAGTCCAGCTTCCAATCTCCCACGGTCCTCTGCGTCTGCAGCACCGTCCCAAGCTGAGCCAGCCTGCCCACCCCGGCAAGCCTGTGGTGGTGGTGGGGCCCATGGGCCAGGCTGGCAAGCAGCCATGGCCTCCACAGCCATCATGGTACCCGTGGGGCTCGTGTTTGTGGCCTTTGCCCTGCATTTCTACCGCTCCTTGGTGGCACACAAGACAGACCGCTA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Michael A Thompson et al.
American journal of respiratory cell and molecular biology, 51(1), 68-76 (2014-01-30)
Plasma membrane Ca(2+) influx, especially store-operated Ca(2+) entry triggered by sarcoplasmic reticulum (SR) Ca(2+) release, is a key component of intracellular calcium concentration ([Ca(2+)]i) regulation in airway smooth muscle (ASM). Agonist-induced Ca(2+) oscillations in ASM that involve both influx and
Carlos Cantonero et al.
International journal of molecular sciences, 21(9) (2020-05-13)
Arachidonic acid (AA) is a phospholipase A2 metabolite that has been reported to mediate a plethora of cellular mechanisms involved in healthy and pathological states such as platelet aggregation, lymphocyte activation, and tissue inflammation. AA has been described to activate
Jingsheng Xia et al.
The Journal of physiology, 592(16), 3443-3461 (2014-05-27)
Store-operated calcium channels (SOCs) are calcium-selective cation channels that mediate calcium entry in many different cell types. Store-operated calcium entry (SOCE) is involved in various cellular functions. Increasing evidence suggests that impairment of SOCE is responsible for numerous disorders. A

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.