콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU131401

Sigma-Aldrich

MISSION® esiRNA

targeting human IGFBP1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CTGCCAAACTGCAACAAGAATGGATTTTATCACAGCAGACAGTGTGAGACATCCATGGATGGAGAGGCGGGACTCTGCTGGTGCGTCTACCCTTGGAATGGGAAGAGGATCCCTGGGTCTCCAGAGATCAGGGGAGACCCCAACTGCCAGATATATTTTAATGTACAAAACTGAAACCAGATGAAATAATGTTCTGTCACGTGAAATATTTAAGTATATAGTATATTTATACTCTAGAACATGCACATTTATATATATATGTATATGTATATATATATAGTAACTACTTTTTATACTCCATACATAACTTGATATAGAAAGCTGTTTATTTATTCACTGTAAGTTTATTTTTTCTACACAGTAAAAACTTGTACTATGTTAATAACTTGTCCTATGTCAATTTGTATATCATGAAACACTTCTCATCATATTGTATGTAAGTAATTGCATTTCTGCTCTTCCAAAGCTCC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Fang Zheng et al.
Experimental & molecular medicine, 50(9), 121-121 (2018-09-14)
β-Elemene, an active component of natural plants, has been shown to exhibit anticancer properties. However, the detailed mechanism underlying these effects has yet to be determined. In this study, we show that β-elemene inhibits the growth of lung cancer cells.
Hideno Tochigi et al.
Scientific reports, 7, 40001-40001 (2017-01-05)
Endometrial decidualization represents an essential step for the successful implantation of the embryo; however, the molecular mechanism behind this differentiation process remains unclear. This study aimed to identify novel microRNAs (miRNAs) involved in the regulation of decidual gene expression in
Ali Vaziri-Gohar et al.
Molecular and cellular endocrinology, 422, 160-171 (2015-12-23)
Tamoxifen, a selective estrogen receptor modulator, is a commonly prescribed adjuvant therapy for estrogen receptor-α (ERα)-positive breast cancer patients. To determine if extracellular factors contribute to the modulation of IGF-1 signaling after tamoxifen treatment, MCF-7 cells were treated with IGF-1 in

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.