콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU130951

Sigma-Aldrich

MISSION® esiRNA

targeting human OVOL1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CAGTCCCAGTGGAGACCTGTTCACCTGCCGTGTCTGCCAGAAGGCCTTCACCTACCAGCGCATGCTGAACCGCCACATGAAGTGTCACAACGACGTCAAGAGGCACCTCTGCACGTACTGCGGGAAGGGCTTCAATGACACCTTCGACCTCAAGAGACACGTCCGAACTCACACTGGCGTGCGGCCCTACAAGTGCAGCCTGTGTGACAAGGCCTTCACGCAGCGCTGCTCTCTGGAGTCTCACCTCAAGAAGATCCATGGTGTGCAGCAGAAGTACGCGTACAAGGAGCGGCGGGCCAAGCTGTACGTGTGTGAGGAGTGCGGCTGCACATCTGAGAGCCAGGAGGGCCACGTCCTGCACCTGAAGGAGCACCACCCTGACAGCCCGCTGCTGCGCAAGACCTCCAAGAAGGTG

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Akiko Hashimoto-Hachiya et al.
International journal of molecular sciences, 19(6) (2018-06-06)
Rhodiola species are antioxidative, salubrious plants that are known to inhibit oxidative stress induced by ultraviolet and γ-radiation in epidermal keratinocytes. As certain phytochemicals activate aryl hydrocarbon receptors (AHR) or OVO-like 1 (OVOL1) to upregulate the expression of epidermal barrier
Maho Murata et al.
Journal of clinical medicine, 9(3) (2020-02-29)
Progression of actinic keratosis (AK) to cutaneous squamous cell carcinoma (cSCC) is rare. Most cases of AK remain as intraepidermal lesions, owing to the suppression of the epithelial-to-mesenchymal transition (EMT). Ovo-like transcriptional repressor 1 (OVOL1) and ovo-like zinc finger 2
Stephen J Renaud et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(45), E6175-E6184 (2015-10-28)
Epithelial barrier integrity is dependent on progenitor cells that either divide to replenish themselves or differentiate into a specialized epithelium. This paradigm exists in human placenta, where cytotrophoblast cells either propagate or undergo a unique differentiation program: fusion into an

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.