콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU130881

Sigma-Aldrich

MISSION® esiRNA

targeting human JAK2

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CATTCCCTTGGGAAATCTGAGGCAGATTATCTGACCTTTCCATCTGGGGAGTATGTTGCAGAAGAAATCTGTATTGCTGCTTCTAAAGCTTGTGGTATCACACCTGTGTATCATAATATGTTTGCTTTAATGAGTGAAACAGAAAGGATCTGGTATCCACCCAACCATGTCTTCCATATAGATGAGTCAACCAGGCATAATGTACTCTACAGAATAAGATTTTACTTTCCTCGTTGGTATTGCAGTGGCAGCAACAGAGCCTATCGGCATGGAATATCTCGAGGTGCTGAAGCTCCTCTTCTTGATGACTTTGTCATGTCTTACCTCTTTGCTCAGTGGCGGCATGATTTTGTGCACGGATGGATAAAAGTACCTGTGACTCATGAAACACAGGAAGAATGTCTTGGGATGGCAGT

Ensembl | 인체 수납 번호

ENSG00000096968

NCBI 수납 번호

NM_004972

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... JAK2(3717) , JAK2(3717)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Xiao-Guang Li et al.
EMBO reports, 20(6) (2019-05-16)
Intracellular tau accumulation forming neurofibrillary tangles is hallmark pathology of Alzheimer's disease (AD), but how tau accumulation induces synapse impairment is elusive. By overexpressing human full-length wild-type tau (termed hTau) to mimic tau abnormality as seen in the brain of
Wudian Xiao et al.
Microbial pathogenesis, 144, 104175-104175 (2020-04-01)
Trichophyton mentagrophytes (T. mentagrophytes) is the main cause of rabbit dermatophytosis. As the main pathogen-associated molecular pattern of T. mentagrophytes, the role of β-glucan in the pathogenesis of rabbit dermatophytosis remains elusive. Keratinocytes (KC) are the main cellular component and the first
Li-Xue Zou et al.
Cells, tissues, organs, 208(1-2), 13-24 (2020-02-12)
The aim of this work was to determine the effect of miR-375 on chondrocyte metabolism and oxidative stress in osteoarthritis (OA) mouse models through the JAK2/STAT3 signaling pathway. Chondrocytes were divided into control, IL-1β, IL-1β + miR-375 mimic, IL-1β +
Xilong Wang et al.
International journal of clinical and experimental pathology, 8(5), 5017-5025 (2015-07-21)
MicroRNAs (miRNAs) have emerged as important regulators that potentially play critical roles in cancer cell biological processes. Previous studies have shown that miR-204 plays an important role in various human cancers. However, the underlying mechanisms of this microRNA in breast
Yuanyuan Zhou et al.
Journal of physiology and biochemistry, 73(2), 259-266 (2017-01-31)
The primary features of Alzheimer's disease (AD) are extracellular amyloid plaques consisting mainly of deposits of amyloid β (Aβ) peptides and intracellular neurofibrillary tangles (NFTs). Sets of evidence suggest that interleukin-5 (IL-5) is involved in the pathogenesis of AD. Herein
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.