콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU128201

Sigma-Aldrich

MISSION® esiRNA

targeting human DEPDC1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GTTGCCATCGATGCTCTACAGTTATGTTGTTTGTTACTTCCCCCACCAAATCGTAGAAAGCTTCAACTTTTAATGCGTATGATTTCCCGAATGAGTCAAAATGTTGATATGCCCAAACTTCATGATGCAATGGGTACGAGGTCACTGATGATACATACCTTTTCTCGATGTGTGTTATGCTGTGCTGAAGAAGTGGATCTTGATGAGCTTCTTGCTGGA

Ensembl | 인체 수납 번호

ENSG00000024526

NCBI 수납 번호

NM_001114120

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... DEPDC1(55635) , DEPDC1(55635)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Anna Tosi et al.
Oncoimmunology, 6(8), e1313371-e1313371 (2017-09-19)
The identification of universal tumor-specific antigens shared between multiple patients and/or multiple tumors is of great importance to overcome the practical limitations of personalized cancer immunotherapy. Recent studies support the involvement of DEPDC1 in many aspects of cancer traits, such
Alboukadel Kassambara et al.
PloS one, 8(4), e62752-e62752 (2013-05-07)
High throughput DNA microarray has made it possible to outline genes whose expression in malignant plasma cells is associated with short overall survival of patients with Multiple Myeloma (MM). A further step is to elucidate the mechanisms encoded by these
Ryogo Kikuchi et al.
Journal of neuro-oncology, 133(2), 297-307 (2017-05-31)
DEP domain containing 1 (DEPDC1) is a novel oncoantigen expressed in cancer cells, which presents oncogenic activity and high immunogenicity. Although DEPDC1 has been predicted to be a useful antigen for the development of a cancer vaccine, its pathophysiological roles

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.