설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TGGCACCTGTACCCTTCTTCTCTCTCCTGCAGTATGAGTGACCACAGGGCCTCCCAGCCCAACATCTCCAGCTGGATCCCAGGGAAATATCAGCCTTGGGCAACTGCAGTGACCAGGGGCACCGGCTGCCCACAGGGAACACATTCCTTTGCTGGGGTTCAGCGCCTCTCCTGGGGCTGGAAGTGCCAAAGCCTGGGGCAAAGCTGTGTTTCAGCCACACTGAACC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Jon Pey et al.
Scientific reports, 7(1), 14358-14358 (2017-11-01)
Constraint-based modeling for genome-scale metabolic networks has emerged in the last years as a promising approach to elucidate drug targets in cancer. Beyond the canonical biosynthetic routes to produce biomass, it is of key importance to focus on metabolic routes
Yi-Fang Cheng et al.
PloS one, 10(11), e0142283-e0142283 (2015-11-07)
The AMP-activated protein kinase (AMPK) signaling system plays a key role in cellular stress by repressing the inflammatory responses induced by the nuclear factor-kappa B (NF-κB) system. Previous studies suggest that the anti-inflammatory role of AMPK involves activation by adenine
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.