설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GCATGTGGTTTGGTTCCTCTCTGGTGGCTCTTTGGGCTGGTATTGGTGGCTTTCCTTGTGGCAGAGGATGTCTCAAACTTCAGATGGGAGGAAAGAGAGCAGGACTCACAGGTTGGAAGAGAATCACCTGGGAAAATACCAGAAAATGAGGGCCGCTTTGAGTCCCCCAGAGATGTCATCAGAGCTCCTCTGTCCTGCTTCTGAATGTGC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... CALCA(796) , CALCA(796)
관련 카테고리
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Yanjun Guo et al.
Peptides, 121, 170121-170121 (2019-08-07)
Endothelial dysfunction is considered to be an initial indicator in diabetes-induced macrovascular complications. Evidence has shown that CGRP is an important neuropeptide active in vascular system, especially in vasorelaxation. This study aimed to investigate the role of CGRP in high-glucose-induced
Yin-Hung Chu et al.
Cells, 9(3) (2020-03-19)
Epithelial-mesenchymal transition (EMT) is strongly correlated with tumor metastasis and contains several protein markers, such as E-cadherin. Carbonic anhydrase III (CA III) exhibits low carbon dioxide hydratase activity in cancer. However, the detailed mechanisms of CA III and their roles
Richard A Byrd et al.
Endocrinology, 156(7), 2417-2428 (2015-04-11)
The tumorigenic potential of dulaglutide was evaluated in rats and transgenic mice. Rats were injected sc twice weekly for 93 weeks with dulaglutide 0, 0.05, 0.5, 1.5, or 5 mg/kg corresponding to 0, 0.5, 7, 20, and 58 times, respectively
John L Vahle et al.
Endocrinology, 156(7), 2409-2416 (2015-04-11)
Glucagon-like peptide-1 (GLP-1) receptor agonists, used for the treatment of type 2 diabetes, have caused hyperplasia/neoplasia of thyroid C cells in rodent carcinogenicity studies. Studies in monkeys have not identified an effect of GLP-1 receptor agonists on thyroid C cells;
Annachiara Sarnella et al.
International journal of molecular sciences, 21(21) (2020-11-14)
Cell plasticity is the ability that cells have to modify their phenotype, adapting to the environment. Cancer progression is under the strict control of the the tumor microenvironment that strongly determines its success by regulating the behavioral changes of tumor
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.