설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GCAAGAAGGAGAGACCATCGAGGATGGGGCTAGGAGGGAGCTGCAGGAGGAGAGCGGTCTGACAGTGGACGCCCTGCACAAGGTGGGCCAGATCGTGTTTGAGTTCGTGGGCGAGCCTGAGCTCATGGACGTGCATGTCTTCTGCACAGACAGCATCCAGGGGACCCCCGTGGAGAGCGACGAAATGCGCCCATGCTGGTTCCAGCTGGATCAGATCCCCTTCAAGGACATGTGGCCCGACGACAGCTACTGGTTTCCACTCCTGCTTCAGAAGAAGAAATTCCACGGGTACTTCAAGTTCCAGGGTCAGGACACCATCCTGGACTACACACTCCGCGAGGTGGACACGGTCTAGCGGGAGCCCAGGGCAGCCCCTGGGCAGGAGACGTGGCTGCTGAACAG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... NUDT1(4521) , NUDT1(4521)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Zhen Chen et al.
Cancer cell international, 20, 337-337 (2020-07-28)
Glioblastoma multiforme (GBM) is the most common and lethal type of primary brain tumor. More than half of GBMs contain mutation(s) of PTEN/PI3K/AKT, making inhibitors targeting the PI3K pathway very attractive for clinical investigation. However, so far, PI3K/AKT/mTOR inhibitors have
Ya Gao et al.
Oncotarget, 8(56), 95865-95879 (2017-12-10)
Cancer cells are more addictive to MTH1 than normal cells because of their dysfunctional redox regulations. MTH1 plays an important role to maintain tumor cell survival, while it is not indispensable for the growth of normal cells. Farnesyl phenols having
Bharathan Bhavya et al.
Life sciences, 264, 118673-118673 (2020-11-02)
The study focused on the expression and role of a recent potential cancer therapeutic target protein, MutT Homolog1 (MTH1). MTH1 gets activated in an increased reactive oxygen species (ROS) environment and removes the oxidized nucleotides from the cell. The study
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.