콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU123931

Sigma-Aldrich

MISSION® esiRNA

targeting human NUDT1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GCAAGAAGGAGAGACCATCGAGGATGGGGCTAGGAGGGAGCTGCAGGAGGAGAGCGGTCTGACAGTGGACGCCCTGCACAAGGTGGGCCAGATCGTGTTTGAGTTCGTGGGCGAGCCTGAGCTCATGGACGTGCATGTCTTCTGCACAGACAGCATCCAGGGGACCCCCGTGGAGAGCGACGAAATGCGCCCATGCTGGTTCCAGCTGGATCAGATCCCCTTCAAGGACATGTGGCCCGACGACAGCTACTGGTTTCCACTCCTGCTTCAGAAGAAGAAATTCCACGGGTACTTCAAGTTCCAGGGTCAGGACACCATCCTGGACTACACACTCCGCGAGGTGGACACGGTCTAGCGGGAGCCCAGGGCAGCCCCTGGGCAGGAGACGTGGCTGCTGAACAG

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Zhen Chen et al.
Cancer cell international, 20, 337-337 (2020-07-28)
Glioblastoma multiforme (GBM) is the most common and lethal type of primary brain tumor. More than half of GBMs contain mutation(s) of PTEN/PI3K/AKT, making inhibitors targeting the PI3K pathway very attractive for clinical investigation. However, so far, PI3K/AKT/mTOR inhibitors have
Ya Gao et al.
Oncotarget, 8(56), 95865-95879 (2017-12-10)
Cancer cells are more addictive to MTH1 than normal cells because of their dysfunctional redox regulations. MTH1 plays an important role to maintain tumor cell survival, while it is not indispensable for the growth of normal cells. Farnesyl phenols having
Bharathan Bhavya et al.
Life sciences, 264, 118673-118673 (2020-11-02)
The study focused on the expression and role of a recent potential cancer therapeutic target protein, MutT Homolog1 (MTH1). MTH1 gets activated in an increased reactive oxygen species (ROS) environment and removes the oxidized nucleotides from the cell. The study

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.