설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ACCAAAGTCAAGTCCGTGCTTGTGGACTTCCTCATTGGCTCCGGCCTCAAGACCATGTCCATCGTGAGTTACAACCACCTGGGCAACAACGATGGGGAGAACCTATCGGCGCCATTGCAGTTCCGCTCTAAGGAGGTGTCCAAGAGCAACGTGGTGGACGACATGGTGCAGAGCAACCCAGTGCTCTATACGCCCGGCGAAGAGCCTGACCACTGCGTGGTCATCAAGTATGTGCCGTACGTGGGTGACAGCAAGCGCGCGCTGGATGAGTATACCTCGGAGCTGATGCTGGGCGGAACCAACACACTGGTGCTGCACAACACGTGTGAGGACTCGCTGCTGGCCGCACCCATCATGCTGGACCTAGCGCTGCTGACCGAGCTGTGCCAGCGCGTGAGCTTCTGCACTGACATGG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... ISYNA1(51477) , ISYNA1(51477)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Lei Li et al.
Neuroscience letters, 672, 46-52 (2018-02-24)
The retinoic acid-inducible gene I (RIG-I) is a crucial cytoplasmic pathogen recognition receptor involved in neuroinflammation in degenerative diseases. In the present study, in vitro human astrocytes were subjected to a chemical hypoxia model using cobalt chloride pretreatment. Chemical hypoxia
Fernando D Villarreal et al.
PloS one, 10(6), e0123212-e0123212 (2015-06-13)
Myo-inositol (Ins) is a major compatible osmolyte in many cells, including those of Mozambique tilapia (Oreochromis mossambicus). Ins biosynthesis is highly up-regulated in tilapia and other euryhaline fish exposed to hyperosmotic stress. In this study, enzymatic regulation of two enzymes
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.