콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU122481

Sigma-Aldrich

MISSION® esiRNA

targeting human NANOS2

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TGGAAGGACTACTTCAACCTGAGCCAGGTGGTGTGGGCGCTGATCGCAAGTCGGGGTCAAAGGCTGGAGACCCAAGAGATTGAGGAGCCAAGTCCCGGGCCTCCGCTGGGGCAGGATCAGGGGCTGGGGGCGCCAGGGGCCAACGGGGGCCTGGGGACCCTGTGCAACTTCTGCAAGCACAACGGGGAGTCCCGCCACGTCTACTCCTCACACCAGCTGAAGACACCGGATGGCGTGGTGGTGTGTCCCATCCTGAGGCACTACGTGTGTCCCGTGTGCGGGGCCACCGGTGACCAGGCCCATACGCTCAAGTACTGCCCGCTTAACGGTGGCCAGCAGTCCCTCTACCGCC

Ensembl | 인체 수납 번호

ENSG00000188425

NCBI 수납 번호

NM_001029861

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... NANOS2(339345) , NANOS2(339345)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Laura M López-Sánchez et al.
Laboratory investigation; a journal of technical methods and pathology, 101(3), 292-303 (2020-12-03)
Cancer stem cells (CSCs) are involved in the resistance of estrogen (ER)-positive breast tumors against endocrine therapy. On the other hand, nitric oxide (NO) plays a relevant role in CSC biology, although there are no studies addressing how this important
Plinio C Casarotto et al.
PeerJ, 6, e4635-e4635 (2018-04-24)
Trichotillomania (TTM) is an impulse control disorder characterized by repetitive hair pulling/trimming. Barbering behavior (BB) observed in laboratory animals is proposed as a model of TTM. The neurobiological basis of TTM is unclear, but involves striatal hyperactivity and hypoactivation of
Huan Liu et al.
Microbiology and immunology, 62(9), 594-606 (2018-07-12)
Transcriptional regulation of inducible nitric oxide synthase (iNOS) is critically involved in the pathogenesis and progression of rheumatoid arthritis (RA); however, the specific transcription factors that control this process remain largely unidentified. In the present study, it was discovered that
Fangqin Wang et al.
Biosensors & bioelectronics, 172, 112756-112756 (2020-11-17)
Acute kidney injury (AKI) is common in hospital patients. Delayed diagnosis and treatment of AKI due to the lack of efficient early diagnosis is an important cause of its high mortality. While fluorescence imaging seems promising to non-intrusively interrogate AKI-related

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.