콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU120331

Sigma-Aldrich

MISSION® esiRNA

targeting human RHOB

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CCCACCGTCTTCGAGAACTATGTGGCCGACATTGAGGTGGACGGCAAGCAGGTGGAGCTGGCGCTGTGGGACACGGCGGGCCAGGAGGACTACGACCGCCTGCGGCCGCTCTCCTACCCGGACACCGACGTCATTCTCATGTGCTTCTCGGTGGACAGCCCGGACTCGCTGGAGAACATCCCCGAGAAGTGGGTCCCCGAGGTGAAGCACTTCTGTCCCAATGTGCCCATCATCCTGGTGGCCAACAAAAAAGACCTGCGCAGCGACGAGCATGTCCGCACAGAGCTGGCCCGCATGAAGCAGGAACCCGTGCGCACGGATGACGGCCGCGCCATGGCCGTGCGCATCCAAGCCTACGACTACCTCGAGTGCTCTGCCAAGACCAAGGAAGGCGTGCGCGAGGTCTTCGAGACGGCCACGCGCGCCGCGCTGCAGAAGCGCTACGGCTCCCAGAACGGCTGCATCAACTGCTGCAAGGTGCTATGAG

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Olivier Calvayrac et al.
EMBO molecular medicine, 9(2), 238-250 (2016-12-23)
Although lung cancer patients harboring EGFR mutations benefit from treatment with EGFR-tyrosine kinase inhibitors (EGFR-TKI), most of them rapidly relapse. RHOB GTPase is a critical player in both lung carcinogenesis and the EGFR signaling pathway; therefore, we hypothesized that it
Li-Juan Wei et al.
Chemico-biological interactions, 289, 9-14 (2018-04-17)
MicroRNAs (miRNAs) can function as tumor suppressor or oncogenic genes. The putative targets of miR-223 include tumor suppressor gene, RhoB. Here we sought to investigate the role of miR-223-RhoB signaling pathway in proliferation of colon cancer. We used Western blot
Shariq S Ansari et al.
Cellular oncology (Dordrecht), 40(1), 89-96 (2016-11-05)
Recently, we found that erufosine (erucylphospho-N,N,N trimethylpropylammonium) can induce up-regulation of RhoB expression in oral squamous carcinoma (OSCC) cells, thereby hinting at a tumor suppressive role. Therefore, we aimed to evaluate the role of RhoB in the tumor suppressive mode
Manon C A Pronk et al.
Molecular biology of the cell, 30(5), 607-621 (2019-01-03)
Rho GTPases control both the actin cytoskeleton and adherens junction stability and are recognized as essential regulators of endothelial barrier function. They act as molecular switches and are primarily regulated by the exchange of GDP and GTP. However, posttranslational modifications

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.