설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TCGGCCTGATCTTTATCGTCTTCGCCGTCCACTTCTACCGCTCACTGGTTAGCCATAAGACTGACCGACAGTTCCAGGAGCTCAACGAGCTGGCGGAGTTTGCCCGCTTACAGGACCAGCTGGACCACAGAGGGGACCACCCCCTGACGCCCGGCAGCCACTATGCCTAGGCCCATGTGGTCTGGGCCCTTCCAGTGCTTTGGCCTTACGCCCTTCCCCTTGACCTTGTCCTGCCCCAGCCTCACGGACAGCCTGCGCAGGGGGCTGGGCTTCAGCAAGGGGCAGAGCATGGAGGGAAGAGGATTTTTATAAGAGAAATTTCTGCACTTTGAAACTGTCCTCTAAGAGAATAAGCATTTCCTGTTCTTCCAGCTCCAGGTCCACCTCCTGTTGGGAGGCGGTGGGGGGCCAAAGTGGGGCCACACACTCGCTGTGTCCCCTCTCCTCCCCTGTGCCAGTGCCACCTGGGTGCCTCCTCCTGTCCTGTCCGTCTCAACCTC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... ORAI1(84876) , ORAI1(84876)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Franz Ewendt et al.
Pflugers Archiv : European journal of physiology, 472(4), 503-511 (2020-03-20)
Bone cells secrete fibroblast growth factor 23 (FGF23), a hormone that inhibits the synthesis of active vitamin D (1,25(OH)2D3) and induces phosphate excretion in the kidney. In addition, it exerts paracrine effects on other cells including hepatocytes, cardiomyocytes, and immune
Ke Ma et al.
Journal of molecular medicine (Berlin, Germany), 97(10), 1465-1475 (2019-08-07)
Compromised renal phosphate elimination in chronic kidney disease (CKD) leads to hyperphosphatemia, which in turn triggers osteo-/chondrogenic signaling in vascular smooth muscle cells (VSMCs) and vascular calcification. Osteo-/chondrogenic transdifferentiation of VSMCs leads to upregulation of the transcription factors MSX2, CBFA1
Shuang Liu et al.
Immunology and cell biology, 92(9), 752-760 (2014-06-18)
The regulated control of Ca(2+) influx is essential for the activation and function of the adaptive immune response, as Ca(2+) is a key regulator of important transcription factors. To determine whether Ca(2+) release-activated Ca(2+) (CRAC) channels contribute to the abnormal
Deng He et al.
International journal of molecular sciences, 16(7), 16313-16329 (2015-07-21)
The molecular events leading to nephrolithiasis are extremely complex. Previous studies demonstrated that calcium and transforming growth factor-β1 (TGF-β1) may participate in the pathogenesis of stone formation, but the explicit mechanism has not been defined. Using a self-created genetic hypercalciuric
Jingsheng Xia et al.
The Journal of physiology, 592(16), 3443-3461 (2014-05-27)
Store-operated calcium channels (SOCs) are calcium-selective cation channels that mediate calcium entry in many different cell types. Store-operated calcium entry (SOCE) is involved in various cellular functions. Increasing evidence suggests that impairment of SOCE is responsible for numerous disorders. A
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.