설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TTGCTGAGCACAATCCCATACCCTTCAGCCTCTGCTCCACAGAGCCTAAGCAAAAGATAGAAACTCACAACTTCCTTGTTTTGTTATCTGGAAATTATCCCAGGATCTGGTGCTTACTCAGCATATTCAAGGAAGGTCTTACTTCATTCTTCCTTGATTGTGACCATGCCCAGGCTCTCTGCTCCCTATAAAAGGCAGGCAGAGCCACCGAGGAGCAGAGAGGTTGAGAACAACCCAGAAACCTTCACCTCTCATGCTGAAGCTCACACCCTTGCCCTCCAAGATGAAGGTTTCTGCAGCGCTTCTGTGCCTGCTGCTCATGGCAGCCACTTTCAGCCCTCAGGGACTTGCTCAGCCAGATTCAGTTTCCATTCCAATCACCTGCTGCTTTAACGTGATCAATAGGAAAATTCCTATCCAGAGGCTGGAGA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... CCL8(6355)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Ying Lu et al.
Brain research bulletin, 139, 235-242 (2018-03-20)
Visceral pain, observed in inflammatory bowel disease (IBD) patients, is a challenging medical problem and remains poorly understood because the mechanisms underlying it are unclear. Emerging evidence indicates that microRNAs (miRNAs) play a crucial role in the pathogenesis of acute
Shipeng Dai et al.
Bioscience, biotechnology, and biochemistry, 84(8), 1585-1593 (2020-05-21)
C-C motif Chemokine ligand 8 (CCL8) has been found in diseases' pathogenesis. But its molecular mechanism in atherosclerosis (AS) remains to be elucidated. Human aortic smooth muscle cells (HASMCs) were stimulated by PDGF-BB to establish cell model. α-SMA in PDGF-BB-stimulated
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.