콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU115611

Sigma-Aldrich

MISSION® esiRNA

targeting human NPM1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GCTGGTGCAAAGGATGAGTTGCACATTGTTGAAGCAGAGGCAATGAATTACGAAGGCAGTCCAATTAAAGTAACACTGGCAACTTTGAAAATGTCTGTACAGCCAACGGTTTCCCTTGGGGGCTTTGAAATAACACCACCAGTGGTCTTAAGGTTGAAGTGTGGTTCAGGGCCAGTGCATATTAGTGGACAGCACTTAGTAGCTGTGGAGGAAGATGCAGAGTCAGAAGATGAAGAGGAGGAGGATGTGAAACTCTTAAGTATATCTGGAAAGCGGTCTGCCCCTGGAGGTGGTAGCAAGGTTCCACAGAAAAAAGTAAAACTTGCTGCTGATGAAGATGATGACGATGATGATGAAGAGGATGATGATGAAGATGATGATGATGATGATTTTGATGATGAGGAAGCTGAAGAAAAAGCGCCAGTGAAGAAA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Derek Hang-Cheong Cheung et al.
Scientific reports, 7, 43650-43650 (2017-03-04)
Telomerase activation and telomere maintenance are critical for cellular immortalization and transformation. PIN2/TERF1-interacting telomerase inhibitor 1 (PinX1) is a telomerase regulator and the aberrant expression of PinX1 causes telomere shortening. Identifying PinX1-interacting proteins is important for understanding telomere maintenance. We
Qing-Qing Wang et al.
Chinese journal of cancer, 30(12), 853-860 (2011-11-22)
Nucleophosmin/B23 (NPM) is a universally expressed nucleolar phosphoprotein that participates in proliferation, apoptosis, ribosome assembly, and centrosome duplication; however, the role of NPM in cell cycle regulation is not well characterized. We investigated the mechanism by which NPM is involved
Laura Arnoldo et al.
Scientific reports, 5, 8552-8552 (2015-02-26)
High Mobility Group A are non-histone nuclear proteins that regulate chromatin plasticity and accessibility, playing an important role both in physiology and pathology. Their activity is controlled by transcriptional, post-transcriptional, and post-translational mechanisms. In this study we provide evidence for
L Lam et al.
Oncogenesis, 1, e4-e4 (2012-01-01)
Nucleophosmin (NPM) is a nucleolar phosphoprotein that is involved in many cellular processes and has both oncogenic and growth suppressing activities. NPM is localized primarily in nucleoli but shuttles between the nucleus and the cytoplasm, and sustained cytoplasmic distribution contributes
Dan Li et al.
The American journal of Chinese medicine, 45(3), 599-614 (2017-04-08)
Abundant evidence supports the key role of ultraviolet radiation (UVR) in skin cancer development. The human skin, especially the epidermal layer, is the main defense against UV radiation. Baicalin is a major bioactive component of Scutellaria baicalensis Georgi, a plant

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.