콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU114821

Sigma-Aldrich

MISSION® esiRNA

targeting human TERF1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CCCTTGATGCACAGTTTGAAAATGATGAACGAATTACACCCTTGGAATCAGCCCTGATGATTTGGGGTTCAATTGAAAAGGAACATGACAAACTTCATGAAGAAATACAGAATTTAATTAAAATTCAGGCTATAGCTGTTTGTATGGAAAATGGCAACTTTAAAGAAGCAGAAGAAGTCTTTGAAAGAATATTTGGTGATCCAAATTCTCATATGCCTTTCAAAAGCAAATTGCTTATGATAATCTCTCAGAAAGATACATTTCATTCCTTTTTTCAACACTTCAGCTACAACCACATGATGGAGAAAATTAAGAGTTATGTGAATTATGTGCTAAGTGAAAAATCATCAACCTTTCTAATGAAGGCAGCGGCAAAAGTAGTAGAAAGCAAAAGGACAAGAACAA

Ensembl | 인체 수납 번호

ENSG00000147601

NCBI 수납 번호

NM_003218

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... TERF1(7013) , TERF1(7013)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Surya Shin Ichi Sutanto et al.
Journal of cell communication and signaling, 13(4), 523-530 (2019-06-17)
People with diabetes mellitus have shorter telomeres compared with non-diabetic subjects. The aim of this study was to investigate an in-vitro model of telomere shortening under diabetes metabolic conditions. The mechanisms of the accelerated telomere length attrition and the potential
Rosa Maria Porreca et al.
eLife, 9 (2020-01-15)
Telomeres are a significant challenge to DNA replication and are prone to replication stress and telomere fragility. The shelterin component TRF1 facilitates telomere replication but the molecular mechanism remains uncertain. By interrogating the proteomic composition of telomeres, we show that
Luxi Sun et al.
Nucleic acids research, 45(7), 3844-3859 (2017-02-06)
Werner syndrome (WS) is a progeroid-like syndrome caused by WRN gene mutations. WS cells exhibit shorter telomere length compared to normal cells, but it is not fully understood how WRN deficiency leads directly to telomere dysfunction. By generating localized telomere-specific
Lu Yang et al.
Nucleic acids research, 45(7), 3906-3921 (2017-02-06)
Oxidative DNA damage triggers telomere erosion and cellular senescence. However, how repair is initiated at telomeres is largely unknown. Here, we found unlike PARP1-mediated Poly-ADP-Ribosylation (PARylation) at genomic damage sites, PARylation at telomeres is mainly dependent on tankyrase1 (TNKS1). TNKS1

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.