설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AACATGTCAGGGTGGGAGTCATATTACAAAACCGAGGGCGATGAAGAAGCAGAGGAAGAACAAGAAGAGAACCTTGAAGCAAGTGGAGACTATAAATATTCAGGAAGAGATAGTTTGATTTTTTTGGTTGATGCCTCCAAGGCTATGTTTGAATCTCAGAGTGAAGATGAGTTGACACCTTTTGACATGAGCATCCAGTGTATCCAAAGTGTGTACATCAGTAAGATCATAAGCAGTGATCGAGATCTCTTGGCTGTGGTGTTCTATGGTACCGAGAAAGACAAAAATTCAGTGAATTTTAAAAATATTTACGTCTTACAGGAGCTGGATAATCCAGGTGCAAAACGAATTCTAGAGCTTGACCAGTTTAAGGGGCAGCAGGGACAAAAACGTTTCCAAGACATGATGGGC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... XRCC6(2547) , XRCC6(2547)
관련 카테고리
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Jiali Ma et al.
Biochemical and biophysical research communications, 484(4), 746-752 (2017-02-06)
The current study focused on the role of Ku70, a DNA-dependent protein kinase (DNA-PK) complex protein, in pancreatic cancer cell resistance to gemcitabine. In both established cell lines (Mia-PaCa-2 and PANC-1) and primary human pancreatic cancer cells, shRNA/siRNA-mediated knockdown of
Ke Luo et al.
OncoTargets and therapy, 11, 7559-7567 (2018-11-23)
As one of the most prevalent malignancies, glioma is characterized by poor prognosis and high mortality rate. Glioma patients may show completely distinct clinical outcomes due to their different molecular patterns. Sirtuin 3 (Sirt3) participates in aging, stress resistance, and
Manila Hada et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 37(10), 13903-13914 (2016-08-05)
The first known function of Ku70 is as a DNA repair factor in the nucleus. Using neuronal neuroblastoma cells as a model, we have established that cytosolic Ku70 binds to the pro-apoptotic protein Bax in the cytosol and blocks Bax's
Raghavendra A Shamanna et al.
Nature communications, 7, 13785-13785 (2016-12-07)
Werner syndrome (WS) is an accelerated ageing disorder with genomic instability caused by WRN protein deficiency. Many features seen in WS can be explained by the diverse functions of WRN in DNA metabolism. However, the origin of the large genomic
B Wang et al.
Cell death and differentiation, 21(7), 1160-1169 (2014-04-29)
Mcl-1 is a unique antiapoptotic Bcl2 family member with a short half-life due to its rapid turnover through ubiquitination. We discovered that Ku70, a DNA double-strand break repair protein, functions as a deubiquitinase to stabilize Mcl-1. Ku70 knockout in mouse
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.